ID: 1175031029

View in Genome Browser
Species Human (GRCh38)
Location 20:55954251-55954273
Sequence CACGAGGCCCTCACCAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175031029_1175031033 9 Left 1175031029 20:55954251-55954273 CCACATCTGGTGAGGGCCTCGTG No data
Right 1175031033 20:55954283-55954305 AGCATGGCAGAAAAGCAGAAGGG No data
1175031029_1175031031 -7 Left 1175031029 20:55954251-55954273 CCACATCTGGTGAGGGCCTCGTG No data
Right 1175031031 20:55954267-55954289 CCTCGTGCTTCTAGATAGCATGG No data
1175031029_1175031032 8 Left 1175031029 20:55954251-55954273 CCACATCTGGTGAGGGCCTCGTG No data
Right 1175031032 20:55954282-55954304 TAGCATGGCAGAAAAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175031029 Original CRISPR CACGAGGCCCTCACCAGATG TGG (reversed) Intergenic
No off target data available for this crispr