ID: 1175036251

View in Genome Browser
Species Human (GRCh38)
Location 20:56004108-56004130
Sequence GCTGCTGGTCCTCACGCTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175036251_1175036259 11 Left 1175036251 20:56004108-56004130 CCGGCAGCGTGAGGACCAGCAGC 0: 1
1: 0
2: 1
3: 28
4: 262
Right 1175036259 20:56004142-56004164 CGCGGACAGCGCCCGGCGCCCGG 0: 1
1: 0
2: 1
3: 25
4: 198
1175036251_1175036260 20 Left 1175036251 20:56004108-56004130 CCGGCAGCGTGAGGACCAGCAGC 0: 1
1: 0
2: 1
3: 28
4: 262
Right 1175036260 20:56004151-56004173 CGCCCGGCGCCCGGAGCCCATGG 0: 1
1: 0
2: 4
3: 23
4: 234
1175036251_1175036255 -7 Left 1175036251 20:56004108-56004130 CCGGCAGCGTGAGGACCAGCAGC 0: 1
1: 0
2: 1
3: 28
4: 262
Right 1175036255 20:56004124-56004146 CAGCAGCACGGCCGGCACCGCGG 0: 1
1: 0
2: 2
3: 15
4: 212
1175036251_1175036257 4 Left 1175036251 20:56004108-56004130 CCGGCAGCGTGAGGACCAGCAGC 0: 1
1: 0
2: 1
3: 28
4: 262
Right 1175036257 20:56004135-56004157 CCGGCACCGCGGACAGCGCCCGG 0: 1
1: 0
2: 5
3: 35
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175036251 Original CRISPR GCTGCTGGTCCTCACGCTGC CGG (reversed) Exonic
900205831 1:1431516-1431538 GCTCCTGGCCCTCAGGCTGGGGG - Intergenic
900844637 1:5087056-5087078 GCTGCTGGGCCTGCCGCTGAAGG + Intergenic
902747782 1:18484705-18484727 GCTGCTGGTGCCCAGGCTGTGGG + Exonic
903037253 1:20500890-20500912 GCAGCTGGGCCTCATGCTCCTGG + Exonic
903675338 1:25061256-25061278 GCTGATGCTCCTGACGCGGCAGG - Intergenic
903996439 1:27307892-27307914 GCTGCTGCTTCTCCTGCTGCTGG + Exonic
904442370 1:30540094-30540116 GCTGTTGGTGTTCAGGCTGCAGG - Intergenic
906052616 1:42887549-42887571 GCTGCTGGTCCTGCCTCTGGTGG - Intergenic
907523662 1:55040863-55040885 GCTTCTGGCCCTCAGGCTGTGGG + Intronic
910200103 1:84690425-84690447 GCTGCTGGCCCTCGGGCTGCGGG - Exonic
910238730 1:85063307-85063329 GCTCCTGGTCCACACCATGCAGG - Intronic
912121105 1:106473212-106473234 GCAGATGGTTCTCAGGCTGCTGG - Intergenic
912203134 1:107480792-107480814 GCTGCTGCTGACCACGCTGCTGG + Exonic
912758247 1:112342712-112342734 GCTGCTGGTGCTCCAGCTGTCGG + Intergenic
912776572 1:112509400-112509422 CCTGCTGCTGCTGACGCTGCCGG + Exonic
913533643 1:119750834-119750856 GCTGCTCGTCCACTCGCTCCAGG + Exonic
914950258 1:152107855-152107877 GCTGCTGTTCCTCCCTCTCCTGG + Exonic
914950339 1:152108503-152108525 GCTGCTGTTCCTCCCTCTCCTGG + Exonic
915544940 1:156591822-156591844 GCTGCTGGGCCTCGGGCTGCTGG + Exonic
920940076 1:210473822-210473844 TCTGCTGGTCTTCAAGCTTCTGG + Intronic
922586143 1:226736447-226736469 GCTGCAGGTCCTCAAGCTCACGG + Exonic
1063121583 10:3108697-3108719 GCAGCTTGTCGTCACGCAGCTGG + Exonic
1067161407 10:43827915-43827937 GCTGCTTGTCCAGATGCTGCAGG + Intergenic
1067329750 10:45304014-45304036 GCTGCTGCTCCTCACGGTCATGG - Exonic
1067944387 10:50681086-50681108 GCTCCTGCTCCTCATGCTCCAGG + Intergenic
1068620349 10:59175907-59175929 GCTGCTGGTCCCGTGGCTGCTGG + Intergenic
1069698317 10:70404179-70404201 GCTGTTGCTCCTGAGGCTGCTGG + Intergenic
1069779451 10:70945648-70945670 GCTGCTGGAACTCATGGTGCAGG - Intergenic
1070315105 10:75302829-75302851 GCTGCTGGTTGTCATGGTGCTGG + Intergenic
1070865887 10:79707957-79707979 GCTCCTGCTCCTCATGCTCCAGG + Intronic
1070879681 10:79846088-79846110 GCTCCTGCTCCTCATGCTCCAGG + Intronic
1071632787 10:87230178-87230200 GCTCCTGCTCCTCATGCTCCAGG + Intronic
1071646236 10:87362396-87362418 GCTCCTGCTCCTCATGCTCCAGG + Intronic
1074827514 10:117225114-117225136 CCTGCTGGTCCCCAGGCAGCAGG - Intergenic
1076305234 10:129461469-129461491 GCTGGTGCTCCTCACGATGCAGG - Intergenic
1076683059 10:132185233-132185255 GCTGCTGGACCTAGCTCTGCTGG + Intergenic
1076739991 10:132478263-132478285 CCTCCTGCTCCTCACCCTGCTGG + Intergenic
1076908849 10:133377612-133377634 GCTGCTGCTGCTCTCGCCGCAGG - Intergenic
1077138561 11:1013500-1013522 GCGGCTCGTACTCACCCTGCAGG - Exonic
1077256182 11:1584500-1584522 GCTGCTGTTCCTCAGGCTGTGGG - Exonic
1077259387 11:1607756-1607778 GCTGCTGCTCCTCAGGCTGTGGG - Exonic
1077259401 11:1607843-1607865 GCTGCTGCTCCTCAGGCTGTGGG - Exonic
1077259420 11:1607960-1607982 GCTGCTGCTCCTCAGGCTGTGGG - Exonic
1077262542 11:1630328-1630350 GCTGCTGCTCCTCAGGCTGTGGG + Exonic
1077274502 11:1697526-1697548 GCTACTGTTCCTCAGGCTGTGGG + Exonic
1077893927 11:6439912-6439934 TCTGCTGTACCTCACACTGCTGG - Intronic
1078549673 11:12271451-12271473 GCAGCTGGGCCTCCGGCTGCTGG - Intergenic
1079812167 11:25008624-25008646 GCTGCTTTTCCTCAGGCTCCAGG + Intronic
1079967312 11:26994748-26994770 CCTGCTGAGCCTCACCCTGCGGG + Exonic
1081636617 11:44726523-44726545 GCTCCTGGGCTTCCCGCTGCCGG - Intronic
1081811071 11:45914412-45914434 GCTGCCGTCCCTCCCGCTGCTGG + Exonic
1081831549 11:46120165-46120187 GCTGCGGCTGCTGACGCTGCCGG - Intronic
1083159180 11:60844132-60844154 GGTCCTGGTACTCACGCTGCAGG + Intronic
1083374511 11:62208740-62208762 GCTGATGGTCCTCATGCTGGCGG + Exonic
1083381230 11:62270225-62270247 GCTGATGGTCCTCATGCTGGCGG + Exonic
1083800106 11:65041616-65041638 GCTCCTGGACCTGGCGCTGCAGG + Exonic
1084046096 11:66568453-66568475 GCTGCAGCTCCTGTCGCTGCTGG - Exonic
1084110830 11:67013360-67013382 GGTGCTGGTCCTCAGGGCGCTGG + Intronic
1084195109 11:67520104-67520126 GCTGATGGGCCCCAAGCTGCTGG - Exonic
1084741881 11:71145556-71145578 CCTGCTGGACCGCAAGCTGCTGG + Intronic
1084798825 11:71527602-71527624 GCTGCTGCTCCTCAGGCTGTGGG + Exonic
1084798838 11:71527689-71527711 GCTGCTGTTCCTCAGGCTGTGGG + Exonic
1084800158 11:71538336-71538358 GCTGTTGCTCCTCAGGCTGTGGG + Exonic
1084800185 11:71538510-71538532 GCTGCTGCTCTTCAGGCTGTGGG + Exonic
1084801829 11:71549058-71549080 GCTGCTCATCCTCAGGCTGTGGG + Exonic
1084806449 11:71582544-71582566 GCTGCTCCTCCTCAGGCTGTGGG - Exonic
1084978352 11:72815383-72815405 GCTGCTGGTCCTCTACCTTCAGG + Intronic
1085403322 11:76247288-76247310 GATGCTGGCCCTCAGGCTGGAGG + Intergenic
1086458540 11:86983120-86983142 GCTGCTCGTCCACTCTCTGCTGG - Intergenic
1087795591 11:102452554-102452576 GCTGCAGGTGCTAGCGCTGCTGG - Exonic
1088794512 11:113256488-113256510 ACTGCTGGATCTCACGCAGCTGG + Intronic
1088905796 11:114154888-114154910 TATGCTGGTCCTCATGCTGTGGG + Intronic
1089967916 11:122668910-122668932 CCTTCTGTTCCTCACGCTGACGG - Intronic
1091277161 11:134360389-134360411 ACTGCTGGTCCTCCCCATGCCGG - Intronic
1091312570 11:134585191-134585213 GCTGGTGGCCCACACCCTGCGGG + Intergenic
1091321832 11:134657314-134657336 GCTGCTGCTGCTCAAGCTCCGGG - Intergenic
1092206970 12:6620666-6620688 GCTGCTGCCCCTCGTGCTGCTGG - Exonic
1093401736 12:18754303-18754325 GCTGCTTCTCCTCTCTCTGCCGG + Intergenic
1094124949 12:27014132-27014154 GCTGCTGGTCGTAGCGGTGCTGG - Exonic
1096071547 12:48778110-48778132 GCTGCCGATTCTCATGCTGCAGG + Exonic
1096123504 12:49103756-49103778 GTTGATGCTCCTCACTCTGCTGG - Exonic
1096154906 12:49336441-49336463 GCTGGTGGCCATCCCGCTGCTGG - Exonic
1096973956 12:55687988-55688010 GCTGCTGGTGCTAGCACTGCTGG - Exonic
1102494173 12:113307712-113307734 TGTGCTGGGGCTCACGCTGCTGG - Exonic
1103853687 12:123949864-123949886 GCCCCTTGTCTTCACGCTGCTGG - Intronic
1104021252 12:124993853-124993875 GCTGCTGCTGCTCGGGCTGCTGG + Exonic
1104892071 12:132144847-132144869 CCTCCTGGTCCTCAGACTGCAGG - Exonic
1104991391 12:132625650-132625672 GCTGATGGCCTTCACCCTGCAGG - Exonic
1105843203 13:24273071-24273093 GCTGCTCGTCCTGGGGCTGCTGG - Intronic
1109102517 13:58203371-58203393 GCTCCTGCTCCTCAAGCTACAGG - Intergenic
1114516252 14:23301972-23301994 GCAGCTGGGCCGCACTCTGCCGG - Intronic
1117369484 14:55063185-55063207 GCTGGTGGTCCCCAGGCTCCTGG - Exonic
1118072300 14:62258350-62258372 TCTGCTGGTCCCCAGGCAGCTGG - Intergenic
1118326830 14:64786904-64786926 GCTGCTGGGACTCACGCTCCAGG + Exonic
1119177183 14:72577636-72577658 GCTCCAGGTCCACATGCTGCTGG + Intergenic
1121111099 14:91313712-91313734 GCTGCTTGTTGTCACGCTCCAGG + Exonic
1121111100 14:91313727-91313749 GCTCCAGGCCCTCAAGCTGCAGG + Exonic
1122774266 14:104110293-104110315 GCTGCTAGTCCTCCTCCTGCTGG - Intronic
1123430135 15:20207822-20207844 CCTCCTGGTGCTCGCGCTGCGGG + Intergenic
1125579652 15:40776244-40776266 TCTGCTGTTCCTCCAGCTGCCGG + Exonic
1125815661 15:42581659-42581681 GCTGCTGCTGCTGAGGCTGCTGG - Intronic
1127827345 15:62716345-62716367 GCTGCTGGTCCTCATTCTCTGGG - Exonic
1128258330 15:66214410-66214432 AGTTCTGGTCCTCATGCTGCAGG + Intronic
1131156481 15:90079092-90079114 GCTGCTCTGCCTCACACTGCGGG - Intronic
1131372854 15:91897737-91897759 GCTGCTGGAGCCCACGCTGCAGG - Intronic
1131466049 15:92655602-92655624 GCTGCTGCTGCTCGCGCTCCTGG - Exonic
1132177753 15:99728756-99728778 GCCACTGGCTCTCACGCTGCAGG + Exonic
1132288941 15:100685990-100686012 GCTGTTGGCCCTCAGGGTGCTGG + Intergenic
1132331321 15:101014161-101014183 GCTGCTGGGCCCCACACAGCTGG + Intronic
1132687085 16:1166856-1166878 GCTGCTGTTCATGGCGCTGCCGG + Intronic
1133118011 16:3589279-3589301 GCTGCTGGTGCTCAGGGGGCCGG + Exonic
1134786925 16:16952973-16952995 GCTGCTGGCCCAACCGCTGCTGG - Intergenic
1136297577 16:29312465-29312487 GGAGATGGTGCTCACGCTGCTGG + Intergenic
1136560875 16:31038560-31038582 GCTGCTGGATCTCACTGTGCCGG - Exonic
1137572241 16:49574483-49574505 GCTGCTGATGCTGATGCTGCTGG + Intronic
1138439110 16:57023806-57023828 GCTGTGGGTCCTCACCCCGCCGG + Exonic
1140127853 16:72132793-72132815 GCTTCTGGACCTCAGCCTGCAGG + Exonic
1141834959 16:86532379-86532401 GGTGCTGGTGCTCACCCTGGAGG + Exonic
1141887931 16:86905519-86905541 TCTGCTGGTGCTCACGCTGGTGG - Intergenic
1142432185 16:90035407-90035429 GCTGCTGCTCTTCAGGCTGTGGG + Intronic
1203116079 16_KI270728v1_random:1491847-1491869 CCTCCTGGTGCTCACCCTGCAGG - Intergenic
1142866649 17:2795430-2795452 GGTGCTGGTCCTCATGCCACAGG - Intronic
1143116578 17:4584791-4584813 GCCGCTGGTTGTCCCGCTGCAGG - Exonic
1143470846 17:7174216-7174238 GCTACTGGTTCTCTCGCTCCGGG - Exonic
1145907370 17:28523915-28523937 GATGCTGGTCCTCACTCTCATGG + Intronic
1146142431 17:30379326-30379348 GCTGCCGGGCCCGACGCTGCGGG + Exonic
1146184697 17:30717250-30717272 GCTTCTGGCCCTCACCTTGCTGG - Intergenic
1146259223 17:31410835-31410857 GCTGGTGGACCTCACCCAGCAGG - Intronic
1147721739 17:42543683-42543705 CCTGCTGGACCTCACTCGGCAGG + Exonic
1147743140 17:42679936-42679958 GCTTCTGGGCCGCACGCTGCTGG - Exonic
1147753091 17:42749327-42749349 CCTGCTGGTCCTCAGGCCACTGG + Intergenic
1147934897 17:44005723-44005745 GCTGGTGGTCCTGGGGCTGCCGG + Exonic
1149656588 17:58312411-58312433 TCTGGTGGTCCTCAAGCAGCTGG - Exonic
1150136033 17:62695743-62695765 GCTGCTGCTCCTCACTCTTTGGG + Intergenic
1151732160 17:75917934-75917956 GCAGCTGCTCGTCACGCTGCCGG + Exonic
1152067783 17:78121113-78121135 GCTGCTGGTCCTGCCCCTGGTGG - Exonic
1152306185 17:79521987-79522009 TCTGCTGCTGCTCCCGCTGCTGG + Intergenic
1152640876 17:81448725-81448747 GCTGCTGGCCCGCACGCGGCAGG + Intronic
1153046805 18:863384-863406 GCTGCTTGTCCTTATGCTACAGG - Intergenic
1155882003 18:31161466-31161488 GTTGATGGTCCTCCCTCTGCAGG + Intronic
1156228633 18:35132906-35132928 GCTGCTGGGCCTCTCTCTCCTGG - Intronic
1159023948 18:63166074-63166096 GCAGCTGGTCCTCATACTGAGGG - Intronic
1160420694 18:78742015-78742037 GCTTCTGGTCCCCAGGCTGGAGG - Intergenic
1160481228 18:79241404-79241426 GCTGTGGGTCCTCACACTACGGG - Intronic
1160494273 18:79361985-79362007 GCTGTTGTTACTCACACTGCAGG - Intronic
1160658517 19:287455-287477 GCTGCTGGTCCACACCCACCTGG + Exonic
1160715020 19:572655-572677 GCTGCTGGGATTCGCGCTGCTGG + Exonic
1160767170 19:813799-813821 GCTGCGGGCCCTGACGCAGCGGG - Exonic
1160893090 19:1389695-1389717 GCTGCACGTGCTCACGCTGCAGG - Intronic
1161564963 19:4996891-4996913 GCTGCTGCTCAGCACCCTGCAGG - Intronic
1162420975 19:10565909-10565931 GCTGCAGTTCCTCGCGCTCCCGG + Exonic
1163215282 19:15871775-15871797 GGTCCTGGCACTCACGCTGCTGG - Intergenic
1163600719 19:18247699-18247721 CCTGCTGTGCCTCATGCTGCTGG + Intronic
1164719162 19:30419686-30419708 CCTCCTGCTCCTCACACTGCTGG - Intronic
1165435204 19:35791504-35791526 GGTGCTGGCCCTCCCACTGCTGG - Intergenic
1166044763 19:40223414-40223436 GCTGCTGTGCCTCGGGCTGCTGG - Exonic
1166067204 19:40366787-40366809 CCTGCTGGTCCTCATTCTGGCGG + Exonic
1167508766 19:49884712-49884734 GCTGCTGCTCCTGAGGGTGCTGG + Exonic
1167513355 19:49908763-49908785 GCTCCTGGTCCTCTAGCTCCAGG + Exonic
1167649711 19:50722690-50722712 GCTGCTGGTCTGCAAGCAGCTGG + Intergenic
1168148956 19:54434882-54434904 GCTGTTGGTTGTCACACTGCAGG + Intronic
1168322611 19:55518839-55518861 GCTGCTGGGGCTGACGCAGCTGG + Exonic
925191949 2:1892238-1892260 GCTGCTGGTGCTGCTGCTGCTGG + Exonic
925368023 2:3324426-3324448 ACTGCTGCTCCTCAGGATGCAGG + Intronic
928235008 2:29531683-29531705 GCAGCTGGTCCTCTGGCTTCTGG + Intronic
935114300 2:100121254-100121276 GCTGCTTCTCCTCTCTCTGCTGG - Intronic
938610728 2:132945116-132945138 GCTGCTGGTCCTCAGGGGACAGG + Intronic
939994739 2:148909299-148909321 GCCGCTGCTCTTCCCGCTGCTGG + Intronic
942178165 2:173354875-173354897 GCTGCTGCTCCTCCTGCTGTGGG + Exonic
942184689 2:173413819-173413841 GCTGCTGGCTCTGACGCGGCTGG + Intergenic
944011808 2:194982979-194983001 CCTGCTGGTCCTAGCTCTGCAGG - Intergenic
945194197 2:207223194-207223216 CCTGCTGGCCCACACGCTGCAGG - Intergenic
945251367 2:207768679-207768701 GCTGCTGCTCCTAGCGCAGCTGG - Exonic
947748313 2:232520586-232520608 GCTCCTGGTCACCATGCTGCTGG + Exonic
947788547 2:232847490-232847512 GCTGCTGCTGCTGACGCTGCTGG - Exonic
947899993 2:233713162-233713184 GGTGGTGGTCCTCACCCTGGAGG + Exonic
948669604 2:239559501-239559523 GCTGTTGGTCCTCACTCGGTGGG + Intergenic
948677582 2:239607850-239607872 GTTGCTGGTTCTCAGCCTGCTGG + Intergenic
948816630 2:240513610-240513632 GTGGCTGGTCCTCATGCTGGTGG - Intronic
1170818403 20:19734798-19734820 GATGCTGTTGCTCATGCTGCTGG - Intergenic
1170961522 20:21029684-21029706 GCTGCTGGTCCCCAGGGTTCAGG - Intergenic
1171489156 20:25504421-25504443 CTTGCTGGGCCTCACACTGCAGG - Intronic
1172272967 20:33664695-33664717 GCTGCTTCTCCTCACTCTCCCGG + Intronic
1172441438 20:34969173-34969195 GCTGCTTGACCTCAGGCTGAAGG + Intergenic
1172596751 20:36155239-36155261 TCTGCTGCTTCTGACGCTGCAGG + Intronic
1172775280 20:37403465-37403487 GCTGTTGGTCCTCTCTCTGTGGG + Exonic
1173334767 20:42103425-42103447 GCTGCTGGTCTCCAGACTGCAGG + Intronic
1173520917 20:43699912-43699934 CTTCCTGGTCCTCACGCTTCGGG - Exonic
1173592479 20:44235612-44235634 AATCCTGGTCCTCACACTGCAGG - Intergenic
1174157790 20:48528044-48528066 GCGGCTCCTCCTCAGGCTGCAGG + Intergenic
1174196688 20:48777287-48777309 GCTCCTGGGCCTCATGCTGGAGG - Intronic
1175036251 20:56004108-56004130 GCTGCTGGTCCTCACGCTGCCGG - Exonic
1176033343 20:63024419-63024441 GCTCCTGGCCCCCACGCCGCTGG + Intergenic
1176111728 20:63413998-63414020 GCTGCCGGTGCTCATGGTGCTGG - Intronic
1178301399 21:31456359-31456381 GCTACTGATCCTCACGCACCTGG - Intronic
1179100420 21:38351329-38351351 ACAGCTGGTCCTGGCGCTGCTGG + Intergenic
1179152652 21:38822109-38822131 GCTCCTGGTTCTAACTCTGCAGG - Intronic
1179718789 21:43303804-43303826 GCAGCTGCTCCCCATGCTGCGGG - Intergenic
1180108650 21:45637333-45637355 GCTGGTGGCACTCACTCTGCTGG - Intergenic
1182485528 22:30636514-30636536 GCTGGTGGTGCTCAGGCGGCTGG + Exonic
1183947677 22:41335965-41335987 GCTGCTGGTCCTGTGGCTGCTGG + Intronic
1185298135 22:50064147-50064169 GCTGCTAGTGCTCCTGCTGCAGG - Exonic
950304601 3:11908232-11908254 GCTGCTGGTGCTCAGGGTGGAGG - Intergenic
950509961 3:13420184-13420206 GCTGCTGCTGCTGACGCTGTCGG - Exonic
950744242 3:15074194-15074216 ACTACTGGTCCTCCTGCTGCAGG - Exonic
953930634 3:47004108-47004130 GCAGGTGGACCTCACGCAGCTGG - Exonic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954394590 3:50286795-50286817 CCTGCTGCTGCTCGCGCTGCTGG + Exonic
954403282 3:50330661-50330683 GCTCCTCCTCCTCCCGCTGCAGG + Exonic
954446106 3:50547703-50547725 GCTGGGGGTCCACAGGCTGCAGG - Intergenic
954661909 3:52230914-52230936 CCCGCTGGGCCTCAGGCTGCAGG + Exonic
955990949 3:64626886-64626908 GCTGATGGGTCTCGCGCTGCAGG - Intronic
960926015 3:122795354-122795376 GCTGCTGCTCTTCTCGCTGCTGG + Exonic
961714309 3:128848213-128848235 GCTGCTGGTGCTCTGGCTGGAGG + Intergenic
967073793 3:185984095-185984117 GATGCTGGTGCTCCTGCTGCTGG + Intergenic
967869054 3:194214555-194214577 GCAGCTGGCCCACATGCTGCAGG + Intergenic
970116586 4:12703334-12703356 GCTTCTGGCCCTCCCGCTCCTGG - Intergenic
971457911 4:26861218-26861240 GTTGCTGGTGCTCGGGCTGCTGG + Exonic
973620712 4:52722617-52722639 TCTGCTGGCGCTCAGGCTGCTGG + Intronic
978374294 4:108059008-108059030 GATGGTGGTCCCCAAGCTGCAGG - Intronic
981117779 4:141012274-141012296 GCTGCTGGTCCTGACCGGGCTGG + Intronic
981331400 4:143513998-143514020 GCTGCTGTTGCTCCCGCCGCTGG - Exonic
985566296 5:619741-619763 GCTGATGGTTCTCACCCTGTAGG + Intronic
985646596 5:1087677-1087699 GCACCAGGTCCTCACGCAGCTGG - Intronic
985796273 5:1964310-1964332 GCAGCTGGACCTCACGGAGCTGG + Intergenic
992793125 5:80231549-80231571 GCTGGTGGTCATGACGCTGGAGG - Intronic
997243053 5:132322308-132322330 GCTGCTGGCGCTGACGGTGCCGG + Exonic
998336131 5:141374122-141374144 GGTCCTGCTCCTCACGCTCCTGG + Exonic
998370167 5:141655743-141655765 GCTGCTGGTCATCGTGCTGGTGG + Exonic
998386558 5:141760489-141760511 GCTCTTGGTCCCCACTCTGCAGG - Intergenic
999262240 5:150245253-150245275 GCTGCTCGTCCTCGCCCTGTGGG - Intronic
999498414 5:152123252-152123274 GCTGCAGGCCATCACGTTGCTGG + Intergenic
1000866295 5:166518832-166518854 GCTGCTTCTCCTCTCTCTGCTGG + Intergenic
1001977189 5:176009769-176009791 GCTGCAGGTCTTCAGGCTGGAGG - Intronic
1002240236 5:177834011-177834033 GCTGCAGGTCTTCAGGCTGGAGG + Intergenic
1002286454 5:178165719-178165741 GCTGCCGGGGCTCAGGCTGCTGG + Intergenic
1002691442 5:181053258-181053280 GCTGTTGGTCCTCGCGGCGCTGG + Exonic
1003566216 6:7224733-7224755 GCTGGAAGTCCTCACACTGCGGG - Intronic
1003624157 6:7727276-7727298 GCTGCTGCTCCTCCTGCTGCCGG - Exonic
1003639127 6:7861962-7861984 GCTGCTGGCTCTGATGCTGCAGG - Intronic
1004160179 6:13205951-13205973 GGTGCTGGGCCACACCCTGCTGG - Exonic
1005292760 6:24395645-24395667 GCTGCTGTTTCTGACTCTGCTGG + Intergenic
1005841716 6:29748351-29748373 GCTCCTGACCCTCACGCTGAGGG - Intergenic
1006186456 6:32184171-32184193 GGTGCTGGTCCTCAGTCTGTGGG - Exonic
1006793465 6:36718040-36718062 GCTGCTGGACCTCGCGGTGGTGG - Exonic
1007350747 6:41271923-41271945 GCTGCTGCTCCTGCTGCTGCAGG - Intronic
1007497200 6:42268372-42268394 GCTGACTGTCCTCACGCTGCTGG + Exonic
1008525692 6:52404651-52404673 GTGGCTGGTCCTCACCCTGTTGG + Exonic
1011277077 6:85642380-85642402 GCTGAACGCCCTCACGCTGCTGG - Intronic
1012872414 6:104687855-104687877 GCAGCTGGTCCTCAAGCAGGAGG - Intergenic
1015549092 6:134393430-134393452 GCAGCTGGCCCTCCTGCTGCTGG - Intergenic
1017989600 6:159474556-159474578 GCTGCTCATCCTGACGATGCAGG - Intergenic
1019542557 7:1558146-1558168 GCTGCTGGTCCTCCCTCTGCAGG + Intronic
1019670981 7:2278192-2278214 GCTGCTGTCCCACACCCTGCAGG - Exonic
1020262110 7:6536448-6536470 GCCGCTGGTCCCCAAGCCGCCGG - Intronic
1022877863 7:34553264-34553286 GTTGCTGCTCCTCCTGCTGCTGG + Intergenic
1023038883 7:36154999-36155021 GGTCCAGGTCCTCACTCTGCAGG - Exonic
1024986935 7:55202348-55202370 GCTACTGGGCCACAGGCTGCAGG - Intronic
1025849328 7:65233080-65233102 GCTGCTTCTCCTCTCTCTGCTGG - Intergenic
1026911869 7:74095747-74095769 GCTGCTGGTCCCCACCCCACCGG + Intronic
1027534630 7:79382003-79382025 GGTGCTGGTCCTGATACTGCTGG + Intronic
1029506482 7:100966482-100966504 GCTGCTGGTGCTGCTGCTGCTGG + Exonic
1032239443 7:130149584-130149606 ACTGCTGGTCCCCAGGCAGCAGG - Intergenic
1032434611 7:131889769-131889791 GCTGCTGGAACCCACGCTGCAGG - Intergenic
1036043221 8:5109794-5109816 GCTCCAGGTGCACACGCTGCGGG + Intergenic
1037427411 8:18771110-18771132 GCTGCTTCTCCTCTCTCTGCTGG + Intronic
1037499350 8:19470466-19470488 GCCTGTGTTCCTCACGCTGCTGG - Intronic
1042877313 8:73451048-73451070 TGTGCTGATCCACACGCTGCCGG + Intronic
1047224674 8:122946219-122946241 GGTGCTGGTCCTCACCTTGCTGG + Intronic
1047807285 8:128373645-128373667 GCTGGTGGTGCTGATGCTGCTGG + Intergenic
1049096216 8:140549815-140549837 GCTGCCACTCCTCAGGCTGCGGG - Intronic
1049740504 8:144238793-144238815 GCTGATGGCCCGCACGCTGTCGG - Exonic
1053020542 9:34691109-34691131 GCTACTGGCCCTCAGCCTGCTGG - Exonic
1057039870 9:91840197-91840219 GCTGCTGGTCCTTGCTCTCCCGG - Intronic
1057252953 9:93518754-93518776 CCTGCTGGTCCTCACACCACAGG - Intronic
1057261334 9:93586483-93586505 GCTGCTGGCCCTCCCCCAGCTGG - Intronic
1057354586 9:94323057-94323079 GCTCCTGCTCCTCAAGCTCCAGG - Intronic
1057489186 9:95508524-95508546 GCTGCTGCTGCTCACACGGCGGG + Exonic
1057653171 9:96934578-96934600 GCTCCTGCTCCTCAAGCTCCAGG + Intronic
1058632519 9:107003813-107003835 GCTGCTGGGGCACACACTGCTGG + Intronic
1058861169 9:109119248-109119270 GCAGCTGTTCCTCCCGGTGCAGG - Intronic
1059696332 9:116733459-116733481 GCTGTTGGTGATCCCGCTGCCGG - Exonic
1060667009 9:125437937-125437959 GCTGCTGTTTCTCACGTTTCAGG - Exonic
1061193678 9:129096084-129096106 CCTGCTGGGCCTGAAGCTGCAGG - Exonic
1061969031 9:134033981-134034003 GCTGGTGTTCCTGTCGCTGCTGG - Intronic
1062247347 9:135576032-135576054 GCTCCTGGTGCTCAGGCTGGTGG + Intergenic
1062326981 9:136017207-136017229 GCTGCAGGTCCTGAGGATGCAGG - Intronic
1062369921 9:136233096-136233118 GCTGTTTGTGCACACGCTGCCGG + Intronic
1062540675 9:137040421-137040443 GCCGCTGGTCCCCAGGCTGTGGG + Exonic
1185464115 X:345246-345268 GCCGCTGGTCCTGAAGCTCCTGG - Intronic
1187095051 X:16139367-16139389 GCAGGTGGTCCGCAGGCTGCGGG - Intronic
1199793663 X:151176672-151176694 GCTGCTGATCCTGAGCCTGCTGG + Exonic