ID: 1175036281

View in Genome Browser
Species Human (GRCh38)
Location 20:56004228-56004250
Sequence GAGCACCGGGATCCCGGGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175036281_1175036293 25 Left 1175036281 20:56004228-56004250 CCTACCCCGGGATCCCGGTGCTC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1175036293 20:56004276-56004298 CAGCGCTGCAGGAGCGACGGCGG 0: 1
1: 0
2: 2
3: 7
4: 142
1175036281_1175036292 22 Left 1175036281 20:56004228-56004250 CCTACCCCGGGATCCCGGTGCTC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1175036292 20:56004273-56004295 CGACAGCGCTGCAGGAGCGACGG 0: 1
1: 0
2: 0
3: 5
4: 71
1175036281_1175036294 28 Left 1175036281 20:56004228-56004250 CCTACCCCGGGATCCCGGTGCTC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1175036294 20:56004279-56004301 CGCTGCAGGAGCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 23
4: 234
1175036281_1175036289 -7 Left 1175036281 20:56004228-56004250 CCTACCCCGGGATCCCGGTGCTC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1175036289 20:56004244-56004266 GGTGCTCGGGAAGATGCTAGCGG 0: 1
1: 0
2: 0
3: 5
4: 94
1175036281_1175036290 -2 Left 1175036281 20:56004228-56004250 CCTACCCCGGGATCCCGGTGCTC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1175036290 20:56004249-56004271 TCGGGAAGATGCTAGCGGCTAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1175036281_1175036291 14 Left 1175036281 20:56004228-56004250 CCTACCCCGGGATCCCGGTGCTC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1175036291 20:56004265-56004287 GGCTAGGTCGACAGCGCTGCAGG 0: 1
1: 0
2: 0
3: 0
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175036281 Original CRISPR GAGCACCGGGATCCCGGGGT AGG (reversed) Exonic
900195118 1:1372022-1372044 GAGCACCGGGAGGCTGGGGCAGG + Intergenic
900980015 1:6040967-6040989 GAGGAACAGGATGCCGGGGTTGG - Intronic
900980473 1:6043414-6043436 AAGCACAGGGATCCCGGCGGGGG - Intronic
901063782 1:6485535-6485557 GAGCGCGGGGACCCCGGGGAGGG + Intronic
901622870 1:10603012-10603034 GAGCACTGGGCTCCCTGGGGTGG - Intronic
903221550 1:21872410-21872432 GAGCACCGGGGTGCCTTGGTGGG + Intronic
903266426 1:22160747-22160769 GAGCATCTGGATCCCTGGGCTGG + Intergenic
903459093 1:23508470-23508492 GAGCACCCACATCCCAGGGTGGG + Exonic
904770488 1:32878514-32878536 GAGCACAGGGTTCCTGGGATAGG + Intergenic
904892246 1:33788209-33788231 GAGAACCAGGATCCCGTGGCCGG + Intronic
905974199 1:42163534-42163556 GAGCCCCAGGAGCCCAGGGTTGG - Exonic
906322540 1:44826225-44826247 GAGCACGGGCACCCCGGGGAGGG - Intronic
918216003 1:182392128-182392150 GAGCCTCGGGACCCCGGGTTGGG - Exonic
921675120 1:217968297-217968319 GAGCACTGGGATGCCTGGGTCGG - Intergenic
922154670 1:223031607-223031629 GAGCAATGGGATCCCGGCCTAGG + Intergenic
922586172 1:226736596-226736618 CAGCTCCGAGTTCCCGGGGTAGG + Exonic
924774447 1:247106034-247106056 GATTACCGGGAGCCCGGCGTTGG - Intergenic
1062761774 10:28044-28066 ATGGACCGGGTTCCCGGGGTAGG + Intergenic
1065883716 10:30059185-30059207 GAGCGCGGGGGTCCCGGGGCGGG - Intronic
1065920964 10:30392554-30392576 GAGCACCCGAAGCCCTGGGTGGG - Intergenic
1067061594 10:43080636-43080658 GGGCACCTGGAGCCCGAGGTGGG - Intronic
1068433986 10:56967551-56967573 GAGCCCCTGGTTCCCAGGGTGGG - Intergenic
1073511063 10:104042636-104042658 AGGCACCGGGACCCCGGGGCAGG + Intronic
1074188674 10:111117255-111117277 GAGCACCTGTCTCCCTGGGTAGG + Intergenic
1075344235 10:121670520-121670542 GAGCACCAGGATTCAGGGCTGGG + Intergenic
1077125541 11:933983-934005 GAGCACAGGGTGCCAGGGGTGGG + Intronic
1078901935 11:15650276-15650298 GAGAACCGCGCCCCCGGGGTGGG + Intergenic
1080529552 11:33161591-33161613 AAGCAGCGAGATCCCGGGGCGGG + Intronic
1083275509 11:61594890-61594912 GAGCCCCGGGAGCCCGGAGGTGG - Intergenic
1083295438 11:61712786-61712808 TAGCCCCGGGAGCCTGGGGTGGG + Intronic
1084101277 11:66951300-66951322 GAGCACCTGGTTCCCTGGCTCGG + Intronic
1084174387 11:67415884-67415906 GGGCACCGGGTCCCGGGGGTGGG - Intronic
1085302669 11:75467577-75467599 GAGCAGCTGGCTCCTGGGGTAGG + Intronic
1089729694 11:120512201-120512223 GAGGACCGCGAGCCCGGGGAAGG - Intronic
1090435387 11:126682848-126682870 GAGGACCGGTACCCCGGGGCTGG + Intronic
1096677135 12:53232003-53232025 GAGCCCCGAGGTCCCGGCGTCGG + Exonic
1101986386 12:109450685-109450707 GAGGAGCGGGATCCCAGGGAGGG + Exonic
1102475306 12:113185059-113185081 GAGCCTTGGGATCCCGGGGCTGG - Intronic
1102505988 12:113384904-113384926 AAGCACCCGGCTCCCGGGGCTGG - Exonic
1104920401 12:132287640-132287662 CAGGACGGGGACCCCGGGGTGGG + Intronic
1110340546 13:74385070-74385092 CAGCACGGGGATCCTGGGCTCGG + Intergenic
1113673859 13:112195061-112195083 CAGCACCAGGAGCCTGGGGTGGG - Intergenic
1114527519 14:23375993-23376015 GAGCAGCAGGATCCCGGGACAGG + Exonic
1117728094 14:58694016-58694038 GAGCTCAGGGATCATGGGGTGGG + Intergenic
1122841678 14:104467770-104467792 GAGCAACTGGATCCTGTGGTGGG - Intergenic
1122881036 14:104690485-104690507 GAGCTGCGGGAGCCCTGGGTGGG - Intronic
1129333603 15:74839883-74839905 GTGCACCGGGAGCCCAGGGATGG - Intronic
1129668250 15:77591851-77591873 GAGCCCCGGTAGCCCAGGGTCGG + Intergenic
1131268011 15:90930115-90930137 GACCGCCGGGCTCCCGGGGTCGG + Exonic
1133050714 16:3115835-3115857 AAGCACGGGGATCCGGGGGGAGG - Exonic
1138425891 16:56931910-56931932 GTGCCCCGGGAACCCGGGTTCGG - Intergenic
1142752879 17:1998762-1998784 GCGCACGGGGACCCCGGGGTGGG + Intronic
1142974840 17:3637020-3637042 GGGCAGCGGGCTGCCGGGGTGGG + Intronic
1145071703 17:19815347-19815369 GAGCACTGGGGTCCCTGGGAGGG - Intronic
1146008355 17:29176593-29176615 GAGAGCCGGGGTCCCGGGGCTGG - Intronic
1147239460 17:39081008-39081030 GAGCCCTGGGATCCTGGGGCTGG - Intronic
1148052363 17:44775492-44775514 GGGAACCGGGATGCGGGGGTGGG + Intronic
1149313845 17:55421375-55421397 GAGCAAAGGGATCCCCGGGAAGG + Intronic
1152684589 17:81687836-81687858 GTCCACCGGGATCCCCGGGCAGG - Intronic
1152954681 18:28374-28396 ATGGACCGGGTTCCCGGGGTAGG + Intergenic
1155053869 18:22169211-22169233 GAGCCCAGGGACCCCGGGGGAGG - Intergenic
1160540420 18:79617523-79617545 CAGCAGCGGGGTCCCGGGGAGGG - Intergenic
1160753690 19:747232-747254 GGGCCCCGGGAGCCGGGGGTGGG + Exonic
1160844649 19:1161051-1161073 GAGCACCGGGAGGTGGGGGTGGG + Intronic
1160844829 19:1161565-1161587 GAGCACTGGGAGCTGGGGGTGGG + Intronic
1161306805 19:3573188-3573210 GAGCCCCGGGATGCCGGGCCCGG - Intronic
1161431101 19:4232995-4233017 GCGGATGGGGATCCCGGGGTGGG - Intronic
1161978934 19:7620664-7620686 CAGCACCTGGACACCGGGGTTGG + Exonic
1162939061 19:13997213-13997235 CAGAACCTGGATCCCGGGGGAGG - Intronic
1163128597 19:15258007-15258029 GAGCACAGCGCCCCCGGGGTAGG - Intronic
1167358893 19:49019587-49019609 GAGCTCCGGGAGCCTGGGGCGGG - Intergenic
1167366589 19:49057836-49057858 GAGCTCCGGGAGCCTGGGGCGGG - Exonic
1167933348 19:52886379-52886401 CAGCACTGGGATGCCGAGGTGGG - Intronic
1168290972 19:55357414-55357436 GACCACGGGGATCCCGGGGTGGG - Intronic
926128561 2:10286374-10286396 CAGCACCGGGCTCCACGGGTGGG + Intergenic
927708557 2:25311582-25311604 CAGCACCGGGATCTAGGGCTGGG + Intronic
928181027 2:29068777-29068799 GAGCACCAGAATCCAGGGGTGGG - Intronic
931233125 2:60390938-60390960 GAACAGCTGGATCCAGGGGTTGG - Intergenic
933658103 2:84905682-84905704 GAGCACCAGGATCTCGGGCTCGG + Exonic
936232152 2:110712348-110712370 GAGCACAGTGCTTCCGGGGTGGG - Intergenic
945995719 2:216434283-216434305 GAGCACCCAGATGCCTGGGTGGG + Intronic
947565301 2:231189710-231189732 GGGCCCCGGGATCCTGGGGGAGG - Intergenic
948046620 2:234951021-234951043 GGGCTCCGGGTTCCCGGGGTGGG + Intergenic
948941428 2:241198778-241198800 GTGCTCCTGGAGCCCGGGGTGGG - Intronic
1170629930 20:18057487-18057509 GGGCGCTGGGCTCCCGGGGTGGG - Intronic
1173913536 20:46689104-46689126 GTGGGCCGGGATCCCGGCGTGGG - Intronic
1174495346 20:50937537-50937559 GAGCACTGGGATTGTGGGGTGGG + Intronic
1175036281 20:56004228-56004250 GAGCACCGGGATCCCGGGGTAGG - Exonic
1175214636 20:57385397-57385419 GCGCACCGGGCTCCCAGGGCAGG + Intergenic
1181056301 22:20261989-20262011 AAGCACTTGAATCCCGGGGTGGG + Intronic
1181089813 22:20464929-20464951 GAGCACCGCGATGCCCTGGTTGG + Exonic
1182667462 22:31970341-31970363 GAGCAGCGGGATGCGGGGGAGGG + Intergenic
1183829629 22:40410899-40410921 GAGCCCTGGGATCCTGGGGTTGG + Exonic
1184331842 22:43832617-43832639 GTGCACTGTGATCCTGGGGTGGG - Intronic
950900261 3:16491216-16491238 GAGCAGGGGGATCCTGGGGGAGG + Intronic
953947631 3:47163535-47163557 GAGCCCCGGGATGGCCGGGTCGG + Intronic
957474451 3:80705449-80705471 GAGCACGGGGATCCTGGGCTGGG + Intergenic
961432925 3:126896002-126896024 GGGCACAGAGACCCCGGGGTGGG - Intronic
962382973 3:134911882-134911904 GAGAGCCAGGATCCCTGGGTGGG - Intronic
966919813 3:184604185-184604207 GAGCACTGGGAGCCAGGGCTGGG - Intronic
967050798 3:185782798-185782820 GTTCACCAGGATCCCAGGGTGGG + Intronic
968073260 3:195801430-195801452 GAGCCCCGGGGCCCCGGGGAGGG - Intronic
968359039 3:198133764-198133786 ATGGACCGGGTTCCCGGGGTAGG - Intergenic
969417337 4:7069130-7069152 GAGCCCTGGGATCCCGGGGAGGG - Intergenic
969417349 4:7069162-7069184 CAGCCCTGGGATCCCGGGGAGGG - Intergenic
969597931 4:8159376-8159398 GAGCGACGGGAGCCTGGGGTGGG - Intergenic
985550005 5:528229-528251 GAGCTCAGGGGCCCCGGGGTTGG + Intergenic
985727609 5:1524152-1524174 GAGCACAGGGATCCCCGGCAGGG + Intergenic
990954653 5:61330949-61330971 GCGCACCCGGGTGCCGGGGTGGG + Intergenic
994439998 5:99790099-99790121 GAGCATTGGGATCCCGGGCCTGG + Intergenic
1001335234 5:170791180-170791202 GAGAACAGGGAGCCTGGGGTAGG + Intronic
1002187786 5:177462553-177462575 GAGGACCGGGGTCTCCGGGTGGG + Intronic
1003725759 6:8761301-8761323 GAGCACAGTGATCTCGGGTTTGG + Intergenic
1006117756 6:31784360-31784382 GGGCACCAGGATCCTGGGCTGGG - Intronic
1006674321 6:35751353-35751375 GAACACCGGGAGCCCGTGGCTGG - Intergenic
1007032241 6:38639423-38639445 GAAACCCGGGACCCCGGGGTGGG - Intronic
1007080820 6:39102497-39102519 GAGCCCGGGGATGCAGGGGTGGG - Intergenic
1013010637 6:106116803-106116825 GAGCACCGTGATCCTCAGGTAGG + Intergenic
1015181586 6:130366495-130366517 GAGCACCGGGCCCTGGGGGTCGG - Intronic
1019483256 7:1275849-1275871 AAGGGCCGGGAGCCCGGGGTGGG + Intergenic
1022689333 7:32631611-32631633 GAGCACCAAGATCAGGGGGTAGG - Intergenic
1022916913 7:34965967-34965989 GAGCACCAAGATCAGGGGGTAGG - Intronic
1023984843 7:45088555-45088577 GAGCCCCACGATCCCTGGGTCGG + Intronic
1029442115 7:100592704-100592726 GGGCAGCTGGATCCTGGGGTGGG - Intronic
1029459569 7:100687179-100687201 GAGCACCGGGATCTCGGACAGGG + Intronic
1029490585 7:100867991-100868013 GAGACCCGGGATCGTGGGGTGGG + Intronic
1031988434 7:128178918-128178940 GAATCCGGGGATCCCGGGGTTGG + Intergenic
1032298743 7:130668239-130668261 GAGCACCCTGTTCCCGGGGCTGG - Intronic
1035750724 8:1994258-1994280 CAGCACTGGGATCCTGGGGCAGG - Intronic
1036723761 8:11201230-11201252 GAGGACGGGGAGCCCGGGGGAGG - Exonic
1036726836 8:11228148-11228170 GAGCACAGGGATGCCTCGGTGGG + Intergenic
1036777045 8:11620714-11620736 GAGAACAGGGATACCGGGCTGGG - Intergenic
1039311351 8:36321367-36321389 GAGCCCAGGGTTCCCGGGGCAGG + Intergenic
1043390337 8:79785547-79785569 CAGCACAGGGCTCCAGGGGTAGG + Intergenic
1044707819 8:95025236-95025258 GGGAAGCGGGGTCCCGGGGTGGG + Intronic
1045300837 8:100908567-100908589 GAGCACAGGGATGCCCGGTTTGG + Intergenic
1047191219 8:122680856-122680878 GCCCACAGGGATCCCAGGGTGGG - Intergenic
1047640965 8:126821192-126821214 GAGGACGGGGATCCCTGGCTAGG - Intergenic
1049247301 8:141569688-141569710 CAGCACCTGGATCCAGGGGAGGG - Intergenic
1049454916 8:142681893-142681915 GAGCAGCGGGATCCGGGGATGGG - Intronic
1049726397 8:144148391-144148413 GACCACCGGGCTCCCGCGGAGGG - Intronic
1049726426 8:144148460-144148482 GACCACCGCGCTCCCGGGGAGGG - Intronic
1049945623 9:592326-592348 GAGCAGCGGGAAGCCGGGGGAGG + Intronic
1051288861 9:15525250-15525272 GAGCACCAGGAACCCAGGGTTGG - Intergenic
1057547870 9:96031608-96031630 AAGCACCAGGATCCAGGGGCTGG + Intergenic
1058144798 9:101399201-101399223 GACAACCGGGATCCCCGGGGGGG - Intronic
1059940012 9:119349576-119349598 TAGAACTGGGAACCCGGGGTTGG + Intronic
1060521700 9:124297748-124297770 GAGCCGCGGGATCCCGGGGACGG + Intronic
1060661305 9:125406806-125406828 CAGCACCTGGATCCCCGGTTGGG - Intergenic
1062003590 9:134228674-134228696 GGGCCCCAGCATCCCGGGGTGGG - Intergenic
1062031444 9:134363800-134363822 GAGCATGGGGATCCCGGGGCCGG + Intronic
1062395568 9:136351303-136351325 GATCACCGGGACCCCCGGGAAGG - Intronic
1062434766 9:136542025-136542047 GCTCACCGGGATCCCAGGTTTGG + Intronic
1062454025 9:136627311-136627333 GAGCACGGGGCTCCCTGGATGGG - Intergenic
1192235318 X:69291840-69291862 GAGCACCTGGAACTCGGGCTGGG + Intergenic
1194654849 X:96560344-96560366 GGGCACGGGGATACAGGGGTGGG - Intergenic
1197774378 X:130110234-130110256 GAGCGCCGGGGCCCCGGCGTGGG - Intronic
1200128933 X:153830709-153830731 GAGGGCCGGGCTCCCGGGGCTGG - Intergenic
1200684051 Y:6244723-6244745 GAGCACTGGGAGCACGTGGTAGG - Intergenic
1200691070 Y:6306576-6306598 GAGCCCCGGGAGCACGTGGTAGG + Intergenic
1201044202 Y:9868140-9868162 GAGCCCCGGGAGCACGTGGTAGG - Intergenic
1201048448 Y:9909118-9909140 GAGCATAGGGATACCGGGGATGG + Intergenic
1201048584 Y:9909663-9909685 GAGCACTGGGAGCACGTGGTAGG + Intergenic