ID: 1175036365

View in Genome Browser
Species Human (GRCh38)
Location 20:56004699-56004721
Sequence GCCTCGCGTTCTTCTCAGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175036365_1175036367 -7 Left 1175036365 20:56004699-56004721 CCAGGCTGAGAAGAACGCGAGGC 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1175036367 20:56004715-56004737 GCGAGGCTGTGTTCATGGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 173
1175036365_1175036370 20 Left 1175036365 20:56004699-56004721 CCAGGCTGAGAAGAACGCGAGGC 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1175036370 20:56004742-56004764 CAGCGACTCCCACTTTCGCCTGG 0: 1
1: 0
2: 1
3: 15
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175036365 Original CRISPR GCCTCGCGTTCTTCTCAGCC TGG (reversed) Exonic