ID: 1175047944

View in Genome Browser
Species Human (GRCh38)
Location 20:56125125-56125147
Sequence CTGTAAATAGAGTGGATGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175047938_1175047944 4 Left 1175047938 20:56125098-56125120 CCACATACACAGGAAGCCCAGGA No data
Right 1175047944 20:56125125-56125147 CTGTAAATAGAGTGGATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175047944 Original CRISPR CTGTAAATAGAGTGGATGCT TGG Intergenic
No off target data available for this crispr