ID: 1175051945

View in Genome Browser
Species Human (GRCh38)
Location 20:56163943-56163965
Sequence CTGTGTCACCAGATGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175051945_1175051953 18 Left 1175051945 20:56163943-56163965 CCCTCCACCATCTGGTGACACAG No data
Right 1175051953 20:56163984-56164006 ACAAGGTGGTCATGTGACTCAGG No data
1175051945_1175051954 22 Left 1175051945 20:56163943-56163965 CCCTCCACCATCTGGTGACACAG No data
Right 1175051954 20:56163988-56164010 GGTGGTCATGTGACTCAGGCTGG No data
1175051945_1175051950 4 Left 1175051945 20:56163943-56163965 CCCTCCACCATCTGGTGACACAG No data
Right 1175051950 20:56163970-56163992 ACCTCCATCACGTGACAAGGTGG No data
1175051945_1175051949 1 Left 1175051945 20:56163943-56163965 CCCTCCACCATCTGGTGACACAG No data
Right 1175051949 20:56163967-56163989 TTTACCTCCATCACGTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175051945 Original CRISPR CTGTGTCACCAGATGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr