ID: 1175055913 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:56198012-56198034 |
| Sequence | GTTTCCTTCTAGTTGAGTGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1175055910_1175055913 | 13 | Left | 1175055910 | 20:56197976-56197998 | CCTTTGGCCTCATCTTCAAGCAA | No data | ||
| Right | 1175055913 | 20:56198012-56198034 | GTTTCCTTCTAGTTGAGTGAGGG | No data | ||||
| 1175055911_1175055913 | 6 | Left | 1175055911 | 20:56197983-56198005 | CCTCATCTTCAAGCAATGTACTT | No data | ||
| Right | 1175055913 | 20:56198012-56198034 | GTTTCCTTCTAGTTGAGTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1175055913 | Original CRISPR | GTTTCCTTCTAGTTGAGTGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||