ID: 1175055913

View in Genome Browser
Species Human (GRCh38)
Location 20:56198012-56198034
Sequence GTTTCCTTCTAGTTGAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175055910_1175055913 13 Left 1175055910 20:56197976-56197998 CCTTTGGCCTCATCTTCAAGCAA No data
Right 1175055913 20:56198012-56198034 GTTTCCTTCTAGTTGAGTGAGGG No data
1175055911_1175055913 6 Left 1175055911 20:56197983-56198005 CCTCATCTTCAAGCAATGTACTT No data
Right 1175055913 20:56198012-56198034 GTTTCCTTCTAGTTGAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175055913 Original CRISPR GTTTCCTTCTAGTTGAGTGA GGG Intergenic
No off target data available for this crispr