ID: 1175057205

View in Genome Browser
Species Human (GRCh38)
Location 20:56209108-56209130
Sequence CTGGCTAGGCAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175057205_1175057214 18 Left 1175057205 20:56209108-56209130 CCCTCCACCTTCTGCCTAGCCAG No data
Right 1175057214 20:56209149-56209171 GCACTTTCAAACAAGGATCCAGG No data
1175057205_1175057213 11 Left 1175057205 20:56209108-56209130 CCCTCCACCTTCTGCCTAGCCAG No data
Right 1175057213 20:56209142-56209164 GACTCTTGCACTTTCAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175057205 Original CRISPR CTGGCTAGGCAGAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr