ID: 1175057788

View in Genome Browser
Species Human (GRCh38)
Location 20:56213931-56213953
Sequence GATGATTTTGTGGGACCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175057788_1175057796 9 Left 1175057788 20:56213931-56213953 CCCTCTGGTCCCACAAAATCATC No data
Right 1175057796 20:56213963-56213985 CTTAACCCTGCGGAGGCCTCAGG No data
1175057788_1175057793 -1 Left 1175057788 20:56213931-56213953 CCCTCTGGTCCCACAAAATCATC No data
Right 1175057793 20:56213953-56213975 CCTGATGCCTCTTAACCCTGCGG No data
1175057788_1175057799 22 Left 1175057788 20:56213931-56213953 CCCTCTGGTCCCACAAAATCATC No data
Right 1175057799 20:56213976-56213998 AGGCCTCAGGAAACACTGTGAGG No data
1175057788_1175057800 23 Left 1175057788 20:56213931-56213953 CCCTCTGGTCCCACAAAATCATC No data
Right 1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG No data
1175057788_1175057794 2 Left 1175057788 20:56213931-56213953 CCCTCTGGTCCCACAAAATCATC No data
Right 1175057794 20:56213956-56213978 GATGCCTCTTAACCCTGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175057788 Original CRISPR GATGATTTTGTGGGACCAGA GGG (reversed) Intergenic
No off target data available for this crispr