ID: 1175057789

View in Genome Browser
Species Human (GRCh38)
Location 20:56213932-56213954
Sequence GGATGATTTTGTGGGACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175057789_1175057800 22 Left 1175057789 20:56213932-56213954 CCTCTGGTCCCACAAAATCATCC No data
Right 1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG No data
1175057789_1175057794 1 Left 1175057789 20:56213932-56213954 CCTCTGGTCCCACAAAATCATCC No data
Right 1175057794 20:56213956-56213978 GATGCCTCTTAACCCTGCGGAGG No data
1175057789_1175057793 -2 Left 1175057789 20:56213932-56213954 CCTCTGGTCCCACAAAATCATCC No data
Right 1175057793 20:56213953-56213975 CCTGATGCCTCTTAACCCTGCGG No data
1175057789_1175057799 21 Left 1175057789 20:56213932-56213954 CCTCTGGTCCCACAAAATCATCC No data
Right 1175057799 20:56213976-56213998 AGGCCTCAGGAAACACTGTGAGG No data
1175057789_1175057796 8 Left 1175057789 20:56213932-56213954 CCTCTGGTCCCACAAAATCATCC No data
Right 1175057796 20:56213963-56213985 CTTAACCCTGCGGAGGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175057789 Original CRISPR GGATGATTTTGTGGGACCAG AGG (reversed) Intergenic
No off target data available for this crispr