ID: 1175057792

View in Genome Browser
Species Human (GRCh38)
Location 20:56213953-56213975
Sequence CCGCAGGGTTAAGAGGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175057792_1175057800 1 Left 1175057792 20:56213953-56213975 CCTGATGCCTCTTAACCCTGCGG No data
Right 1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG No data
1175057792_1175057799 0 Left 1175057792 20:56213953-56213975 CCTGATGCCTCTTAACCCTGCGG No data
Right 1175057799 20:56213976-56213998 AGGCCTCAGGAAACACTGTGAGG No data
1175057792_1175057802 10 Left 1175057792 20:56213953-56213975 CCTGATGCCTCTTAACCCTGCGG No data
Right 1175057802 20:56213986-56214008 AAACACTGTGAGGGTGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175057792 Original CRISPR CCGCAGGGTTAAGAGGCATC AGG (reversed) Intergenic
No off target data available for this crispr