ID: 1175057794

View in Genome Browser
Species Human (GRCh38)
Location 20:56213956-56213978
Sequence GATGCCTCTTAACCCTGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175057788_1175057794 2 Left 1175057788 20:56213931-56213953 CCCTCTGGTCCCACAAAATCATC No data
Right 1175057794 20:56213956-56213978 GATGCCTCTTAACCCTGCGGAGG No data
1175057789_1175057794 1 Left 1175057789 20:56213932-56213954 CCTCTGGTCCCACAAAATCATCC No data
Right 1175057794 20:56213956-56213978 GATGCCTCTTAACCCTGCGGAGG No data
1175057790_1175057794 -7 Left 1175057790 20:56213940-56213962 CCCACAAAATCATCCTGATGCCT No data
Right 1175057794 20:56213956-56213978 GATGCCTCTTAACCCTGCGGAGG No data
1175057791_1175057794 -8 Left 1175057791 20:56213941-56213963 CCACAAAATCATCCTGATGCCTC No data
Right 1175057794 20:56213956-56213978 GATGCCTCTTAACCCTGCGGAGG No data
1175057787_1175057794 3 Left 1175057787 20:56213930-56213952 CCCCTCTGGTCCCACAAAATCAT No data
Right 1175057794 20:56213956-56213978 GATGCCTCTTAACCCTGCGGAGG No data
1175057785_1175057794 30 Left 1175057785 20:56213903-56213925 CCAGGCTGTGGAAGATCTGCTGC No data
Right 1175057794 20:56213956-56213978 GATGCCTCTTAACCCTGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175057794 Original CRISPR GATGCCTCTTAACCCTGCGG AGG Intergenic
No off target data available for this crispr