ID: 1175057795

View in Genome Browser
Species Human (GRCh38)
Location 20:56213960-56213982
Sequence GAGGCCTCCGCAGGGTTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175057795_1175057805 30 Left 1175057795 20:56213960-56213982 CCTCTTAACCCTGCGGAGGCCTC No data
Right 1175057805 20:56214013-56214035 AAAGCCTAGATGAGCCGGACCGG No data
1175057795_1175057804 25 Left 1175057795 20:56213960-56213982 CCTCTTAACCCTGCGGAGGCCTC No data
Right 1175057804 20:56214008-56214030 GCACAAAAGCCTAGATGAGCCGG No data
1175057795_1175057799 -7 Left 1175057795 20:56213960-56213982 CCTCTTAACCCTGCGGAGGCCTC No data
Right 1175057799 20:56213976-56213998 AGGCCTCAGGAAACACTGTGAGG No data
1175057795_1175057802 3 Left 1175057795 20:56213960-56213982 CCTCTTAACCCTGCGGAGGCCTC No data
Right 1175057802 20:56213986-56214008 AAACACTGTGAGGGTGTCCAAGG No data
1175057795_1175057800 -6 Left 1175057795 20:56213960-56213982 CCTCTTAACCCTGCGGAGGCCTC No data
Right 1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175057795 Original CRISPR GAGGCCTCCGCAGGGTTAAG AGG (reversed) Intergenic
No off target data available for this crispr