ID: 1175057800

View in Genome Browser
Species Human (GRCh38)
Location 20:56213977-56213999
Sequence GGCCTCAGGAAACACTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175057790_1175057800 14 Left 1175057790 20:56213940-56213962 CCCACAAAATCATCCTGATGCCT No data
Right 1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG No data
1175057787_1175057800 24 Left 1175057787 20:56213930-56213952 CCCCTCTGGTCCCACAAAATCAT No data
Right 1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG No data
1175057789_1175057800 22 Left 1175057789 20:56213932-56213954 CCTCTGGTCCCACAAAATCATCC No data
Right 1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG No data
1175057795_1175057800 -6 Left 1175057795 20:56213960-56213982 CCTCTTAACCCTGCGGAGGCCTC No data
Right 1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG No data
1175057792_1175057800 1 Left 1175057792 20:56213953-56213975 CCTGATGCCTCTTAACCCTGCGG No data
Right 1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG No data
1175057791_1175057800 13 Left 1175057791 20:56213941-56213963 CCACAAAATCATCCTGATGCCTC No data
Right 1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG No data
1175057788_1175057800 23 Left 1175057788 20:56213931-56213953 CCCTCTGGTCCCACAAAATCATC No data
Right 1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175057800 Original CRISPR GGCCTCAGGAAACACTGTGA GGG Intergenic
No off target data available for this crispr