ID: 1175060349

View in Genome Browser
Species Human (GRCh38)
Location 20:56236492-56236514
Sequence CAAGATCTGATGGGCTTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175060346_1175060349 10 Left 1175060346 20:56236459-56236481 CCATGCTATTCTCGTGATAGTGA 0: 235
1: 2136
2: 7390
3: 8383
4: 6634
Right 1175060349 20:56236492-56236514 CAAGATCTGATGGGCTTATTAGG No data
1175060345_1175060349 11 Left 1175060345 20:56236458-56236480 CCCATGCTATTCTCGTGATAGTG 0: 167
1: 1620
2: 6202
3: 9342
4: 8271
Right 1175060349 20:56236492-56236514 CAAGATCTGATGGGCTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175060349 Original CRISPR CAAGATCTGATGGGCTTATT AGG Intergenic
No off target data available for this crispr