ID: 1175063536

View in Genome Browser
Species Human (GRCh38)
Location 20:56265665-56265687
Sequence TTCTGATGCGAGGAGTAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175063533_1175063536 -7 Left 1175063533 20:56265649-56265671 CCAAAGCCTGAGCTGTTTCTGAT No data
Right 1175063536 20:56265665-56265687 TTCTGATGCGAGGAGTAAAATGG No data
1175063529_1175063536 18 Left 1175063529 20:56265624-56265646 CCAAGAGGCACGCCCAGGTCTGA No data
Right 1175063536 20:56265665-56265687 TTCTGATGCGAGGAGTAAAATGG No data
1175063531_1175063536 5 Left 1175063531 20:56265637-56265659 CCAGGTCTGAGCCCAAAGCCTGA No data
Right 1175063536 20:56265665-56265687 TTCTGATGCGAGGAGTAAAATGG No data
1175063530_1175063536 6 Left 1175063530 20:56265636-56265658 CCCAGGTCTGAGCCCAAAGCCTG No data
Right 1175063536 20:56265665-56265687 TTCTGATGCGAGGAGTAAAATGG No data
1175063532_1175063536 -6 Left 1175063532 20:56265648-56265670 CCCAAAGCCTGAGCTGTTTCTGA No data
Right 1175063536 20:56265665-56265687 TTCTGATGCGAGGAGTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175063536 Original CRISPR TTCTGATGCGAGGAGTAAAA TGG Intergenic
No off target data available for this crispr