ID: 1175064790

View in Genome Browser
Species Human (GRCh38)
Location 20:56275607-56275629
Sequence TACTTAGGAAGTCCAAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175064790_1175064793 2 Left 1175064790 20:56275607-56275629 CCTTGCTTTGGACTTCCTAAGTA No data
Right 1175064793 20:56275632-56275654 TCCACAGTGGTAATAGCCCCTGG No data
1175064790_1175064795 9 Left 1175064790 20:56275607-56275629 CCTTGCTTTGGACTTCCTAAGTA No data
Right 1175064795 20:56275639-56275661 TGGTAATAGCCCCTGGTTCAAGG No data
1175064790_1175064801 26 Left 1175064790 20:56275607-56275629 CCTTGCTTTGGACTTCCTAAGTA No data
Right 1175064801 20:56275656-56275678 TCAAGGTGGCTGTCATGCAAGGG No data
1175064790_1175064800 25 Left 1175064790 20:56275607-56275629 CCTTGCTTTGGACTTCCTAAGTA No data
Right 1175064800 20:56275655-56275677 TTCAAGGTGGCTGTCATGCAAGG No data
1175064790_1175064796 12 Left 1175064790 20:56275607-56275629 CCTTGCTTTGGACTTCCTAAGTA No data
Right 1175064796 20:56275642-56275664 TAATAGCCCCTGGTTCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175064790 Original CRISPR TACTTAGGAAGTCCAAAGCA AGG (reversed) Intergenic
No off target data available for this crispr