ID: 1175068143

View in Genome Browser
Species Human (GRCh38)
Location 20:56308051-56308073
Sequence CAGCTAGGGTTGCCACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175068143_1175068147 12 Left 1175068143 20:56308051-56308073 CCAGCCTGTGGCAACCCTAGCTG No data
Right 1175068147 20:56308086-56308108 AACCTATAGTTATAAGCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175068143 Original CRISPR CAGCTAGGGTTGCCACAGGC TGG (reversed) Intergenic
No off target data available for this crispr