ID: 1175069031

View in Genome Browser
Species Human (GRCh38)
Location 20:56316334-56316356
Sequence GACTCAGGACTGTTGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175069017_1175069031 22 Left 1175069017 20:56316289-56316311 CCTGGGGAAAGTTTTCAAGTCCT No data
Right 1175069031 20:56316334-56316356 GACTCAGGACTGTTGGGGGCAGG No data
1175069023_1175069031 -7 Left 1175069023 20:56316318-56316340 CCTCCACCTGGAAGTGGACTCAG No data
Right 1175069031 20:56316334-56316356 GACTCAGGACTGTTGGGGGCAGG No data
1175069025_1175069031 -10 Left 1175069025 20:56316321-56316343 CCACCTGGAAGTGGACTCAGGAC No data
Right 1175069031 20:56316334-56316356 GACTCAGGACTGTTGGGGGCAGG No data
1175069020_1175069031 2 Left 1175069020 20:56316309-56316331 CCTTCAGGCCCTCCACCTGGAAG No data
Right 1175069031 20:56316334-56316356 GACTCAGGACTGTTGGGGGCAGG No data
1175069022_1175069031 -6 Left 1175069022 20:56316317-56316339 CCCTCCACCTGGAAGTGGACTCA No data
Right 1175069031 20:56316334-56316356 GACTCAGGACTGTTGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175069031 Original CRISPR GACTCAGGACTGTTGGGGGC AGG Intergenic
No off target data available for this crispr