ID: 1175076458

View in Genome Browser
Species Human (GRCh38)
Location 20:56378866-56378888
Sequence CAGAGATGGAAGGGTTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 1, 1: 0, 2: 7, 3: 44, 4: 576}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175076458 Original CRISPR CAGAGATGGAAGGGTTGGAA GGG Intronic
901158139 1:7154446-7154468 AAGTGATGGCGGGGTTGGAAAGG - Intronic
901211694 1:7530087-7530109 CAGAGAAGGGAGGGTAGCAAGGG - Intronic
901377367 1:8848974-8848996 GAGAGAAGGAAGGGCTGGGATGG + Intergenic
901483383 1:9540947-9540969 CATGGAGGGAAGGGTTGCAAGGG - Intronic
902152782 1:14458418-14458440 AAGAGATGGAAGAATTGAAAGGG - Intergenic
902247061 1:15127970-15127992 CAGAGAAGGAAGAGATGGAAGGG - Intergenic
902890218 1:19437958-19437980 CAGGGATTCAAGGGTTAGAAGGG - Intronic
902916480 1:19643164-19643186 CAGAGATGAAAGGAGGGGAAGGG + Intronic
903301044 1:22379082-22379104 CACAGCTGGAGGGGTTGGGAGGG - Intergenic
903542355 1:24103923-24103945 GAGAGATGGAGGGGTTGAAAAGG - Intronic
903747596 1:25598644-25598666 CAGTGTTGGGAGGGTTGGAGAGG - Intergenic
904645317 1:31961268-31961290 CAGAGCTGGAACTATTGGAACGG + Intergenic
904810421 1:33160033-33160055 CAGAGAGGAAAGGGTGGGAAAGG + Intronic
904896946 1:33824661-33824683 GTGAGATGGAAGGGGAGGAATGG + Intronic
905485541 1:38293183-38293205 CGGAGATGGAGGTGTTGGCAGGG + Intergenic
905566261 1:38967512-38967534 AAGAGATGGAGGAGGTGGAAGGG + Intergenic
906190379 1:43895234-43895256 AGGATAAGGAAGGGTTGGAAGGG - Intronic
906750405 1:48253579-48253601 CAAAGATGAGAGGTTTGGAAAGG - Intergenic
906798251 1:48714487-48714509 GAGAGATTGAAGGGGTGGATGGG - Intronic
906900006 1:49824653-49824675 CAGAGAAAGAAGGGTAGGAATGG + Intronic
907303816 1:53503081-53503103 CAGAGAGGGAAGGGCGGGACAGG + Intergenic
907485324 1:54774101-54774123 CAGAAATGGAAGGCTAGTAAGGG + Intergenic
907726222 1:57023212-57023234 CAGAGGTGGAAGAGTGGAAATGG + Intronic
908316075 1:62933850-62933872 CAGAGATGGACCGCTTGGAATGG - Intergenic
908389098 1:63669400-63669422 CAGAGATAGAAAGGTTGGCTCGG - Intergenic
909149392 1:71981784-71981806 GAGATTTGGAAGGGTTAGAAGGG + Intronic
909706262 1:78588170-78588192 CAGAGGAGGAAGGGGTGGTATGG + Intergenic
910105407 1:83626542-83626564 CACAGAAGGAAAGGATGGAAAGG + Intergenic
911237004 1:95422410-95422432 TTGACATGGAAGGGCTGGAATGG + Intergenic
911634973 1:100225208-100225230 GAGGGTAGGAAGGGTTGGAAAGG - Intronic
911889048 1:103343586-103343608 CAGATATGGAAAAGTTGGATGGG + Intergenic
912626016 1:111204759-111204781 GAGAGGTGGAGGGGTTGGAGAGG - Intronic
912645046 1:111384346-111384368 GAGAGGAGGAAGGGTTGGATGGG - Intergenic
913356116 1:117923912-117923934 CAGAAAAGGAAAGGTTGGATGGG - Intronic
913552465 1:119929042-119929064 CAGAGCTGCAGGGGTTGGAGAGG + Exonic
913997721 1:143665238-143665260 TACAGATGGAGAGGTTGGAAAGG - Intergenic
914508145 1:148307201-148307223 CACAGATGGAGAGGTTGGAAAGG - Intergenic
915217244 1:154348569-154348591 CAGAGATGGGGTGGCTGGAAAGG + Intronic
915222824 1:154388602-154388624 TAGAGATGGATGGATTGGAGAGG - Intergenic
917420436 1:174857601-174857623 CAGAGATAGGAGGGTTATAAAGG - Intronic
918284882 1:183042479-183042501 CAGTGATGGATGGGTTGGTGGGG + Intronic
919120921 1:193339346-193339368 GAGGGATGGAAGGGTGGCAAGGG - Intergenic
919355158 1:196512949-196512971 CACAGAAGGAAGTATTGGAAAGG + Intronic
919636941 1:200012425-200012447 CAGAGTTTGCAGAGTTGGAATGG - Intergenic
920816599 1:209340315-209340337 CTGTGGTGGAAGGGTAGGAAGGG - Intergenic
921080383 1:211734337-211734359 AAGAGGTGGAGGTGTTGGAAGGG + Intergenic
921454002 1:215344895-215344917 CAGAGATGGAAAGGTGCCAAAGG - Intergenic
921641101 1:217555708-217555730 CAGAGGAGGAAAAGTTGGAAAGG - Intronic
921785869 1:219229175-219229197 CCGATATGGAAGTGTTGGGAAGG + Intergenic
922609777 1:226917421-226917443 CTGGGAGGCAAGGGTTGGAAAGG - Intronic
922735927 1:227978237-227978259 CAGAGAAGGGGGGGTTGGAGAGG + Intergenic
923161270 1:231316908-231316930 AAGAGATGGAGGGGATGGAAAGG - Intergenic
923161272 1:231316917-231316939 CAGAGGTGGAAGAGATGGAGGGG - Intergenic
1062862288 10:820107-820129 CAAAGATGGGAGGGATGGCACGG - Intronic
1063387954 10:5628241-5628263 CAGTGAGGAAAGGGTCGGAAAGG + Intergenic
1063692121 10:8296851-8296873 CAGAGAAGGAGGGGAGGGAAGGG - Intergenic
1063887363 10:10593298-10593320 CAGAGATGGAAGATCTAGAACGG + Intergenic
1064230160 10:13522683-13522705 CAGAGTTGGAAGGGGTAGAGGGG - Intronic
1064482825 10:15756696-15756718 CAGAGCTGGGAGGGTAGGGAAGG + Intergenic
1064575454 10:16741367-16741389 GAGAGATGGACGGATTGGAGTGG + Intronic
1064624235 10:17246055-17246077 AAGAGATGGAAGGGGTGAAAAGG + Intergenic
1065198118 10:23286516-23286538 GAGGGAAGGAAGGGTGGGAAGGG + Intronic
1065497220 10:26341824-26341846 CAGGGAAGGAAGGGAAGGAAGGG + Intergenic
1066067814 10:31774941-31774963 CAGAGCTGGAAGGACTGGAGGGG - Intergenic
1066129751 10:32381355-32381377 CAGAGGTGGAGGAGGTGGAAGGG + Intergenic
1066669256 10:37819625-37819647 CAGAGCTGGAAAGGCTAGAAAGG - Intronic
1066734165 10:38455872-38455894 CAGAGAAGGGGGGGTTGGAGAGG + Intergenic
1068094421 10:52472554-52472576 AACAGTTGGAAGGATTGGAAAGG + Intergenic
1068105470 10:52609547-52609569 CAGAGAGAGAAGAGTTGTAATGG - Intergenic
1068522051 10:58087654-58087676 CAGAGATGGAGGATGTGGAAGGG - Intergenic
1069357788 10:67607522-67607544 AAGAGATGGAGGAGGTGGAAGGG + Intronic
1069452629 10:68529209-68529231 CAGAGGTGGTAGGGGAGGAATGG - Intergenic
1069733271 10:70633329-70633351 AAGAGATGGAGGAGGTGGAAGGG - Intergenic
1070810093 10:79293287-79293309 CAGGGAGGGAAGGGTTGGGGAGG - Intronic
1072039232 10:91591434-91591456 CAGAGAGGGTAGGGTGGGGAGGG - Intergenic
1073775568 10:106781871-106781893 CAGTGAAGGAAGGGGAGGAAGGG + Intronic
1073865096 10:107793548-107793570 CAGAGATGGATGCTTTGGAGGGG - Intergenic
1074112061 10:110429736-110429758 CAGAGAAGGAAGGGAGGGAAGGG - Intergenic
1074734844 10:116419587-116419609 CAGAAGTGGGAGGGTAGGAAGGG - Intergenic
1074960126 10:118437132-118437154 CACAGATGGAAGGAAAGGAATGG - Intergenic
1075603234 10:123786309-123786331 CAGAGACGGACGGGTGGCAAAGG + Intronic
1075723147 10:124598813-124598835 CAGAGATGGATGGATGGGGATGG - Intronic
1076576610 10:131473927-131473949 CAGGGATGGCAGGGATGGCAGGG + Intergenic
1077165875 11:1138048-1138070 AAGAGATGGAGGAGGTGGAAGGG + Intergenic
1077219015 11:1407211-1407233 CAGAGAGGGCAGGGGTGGGAAGG - Intronic
1077843328 11:5998303-5998325 AAGAGGTGGTAGGGTTGGAAGGG - Intergenic
1077846589 11:6031916-6031938 CATAAATGGAAGGGCTAGAAAGG + Intergenic
1079245191 11:18746916-18746938 CAAATATGGAACGGTGGGAAGGG + Intronic
1079414719 11:20223047-20223069 CAGAGAAGAAAGAGGTGGAAAGG - Intergenic
1079478160 11:20853234-20853256 CAGAGAAGGAAGTGTGGGAAAGG + Intronic
1080725619 11:34897509-34897531 CAGAGAGGGTAAGGTTGGTAAGG + Intronic
1080936726 11:36871271-36871293 GAGAGATGGAGGGGGTGGGAGGG + Intergenic
1081279715 11:41193975-41193997 AAGAGATGGAGGAGATGGAAGGG - Intronic
1082215345 11:49561238-49561260 AAGAGCTGCAAGGGTTGAAAAGG + Intergenic
1083024028 11:59534736-59534758 CTGCGATGGAGGGGTTGGAGGGG + Intergenic
1083226728 11:61290085-61290107 CAGAGTTGGGAGGGTTGGCCAGG - Intronic
1083827583 11:65212089-65212111 AGGAGATGGAGGGGTTGGAGGGG - Intergenic
1085091419 11:73718160-73718182 CAGAGAGAGAATGGCTGGAAGGG + Intronic
1086498421 11:87427226-87427248 CTGAGATGGAAGGGCTGGGCTGG + Intergenic
1086634226 11:89063240-89063262 AAGAGCTGCAAGGGTTGAAAAGG - Intronic
1087066785 11:94034856-94034878 CAGAGGTGGAAGGTAAGGAAGGG + Intronic
1087319974 11:96646294-96646316 CAGAAATGCAATGGTTAGAAGGG - Intergenic
1088188274 11:107197723-107197745 CAGAGGAGGAAGGGTAGGATGGG - Intergenic
1088588870 11:111384185-111384207 AAGAGATGGAAGAATCGGAAGGG - Intronic
1088684602 11:112274313-112274335 CAGAGAGGGAAGGTTTGCGATGG + Intergenic
1089214526 11:116827651-116827673 CAGAGATGGAAAGGCTTGGAGGG + Intergenic
1089214864 11:116829353-116829375 CAGAGATGGAGGTGCTGGGAGGG + Intergenic
1089730141 11:120514071-120514093 CAGAGATGGAAGGGAGGACAGGG + Intronic
1090047348 11:123347572-123347594 CAGGGAGGGAAGGGGTAGAAGGG - Intergenic
1090069828 11:123534465-123534487 CAGAGATGGAGAGGTAGTAATGG + Intronic
1090264045 11:125342972-125342994 TAGAGATGGAGGGGCTGGAGAGG + Intronic
1090795931 11:130135670-130135692 AAGGGGTGGAAGGGGTGGAACGG - Exonic
1090951075 11:131473839-131473861 CAGAGATGGAAGGAATAGATGGG - Intronic
1091102865 11:132891957-132891979 GAGAGAAGCAAGGGTGGGAACGG - Intronic
1092941943 12:13418057-13418079 CAGAGATGGAAGGATGGGGATGG - Intergenic
1092947996 12:13474769-13474791 CAGAGAAGAAAGTGGTGGAAAGG - Intergenic
1093195654 12:16126775-16126797 CAGAGAAAGAAGGGGAGGAAAGG + Intergenic
1093500433 12:19806015-19806037 GAGAGATGGCAGGATTGGGAGGG + Intergenic
1093797432 12:23329357-23329379 AAGAGGTGTAAGGATTGGAAAGG + Intergenic
1093834359 12:23808284-23808306 GAGAGATGGTGGGGTGGGAAGGG - Intronic
1093971106 12:25376852-25376874 CAAAGAGGGAAGGGAGGGAAAGG + Intergenic
1094148994 12:27261169-27261191 GAGAGGTGGAAGGGTTAGCAAGG + Intronic
1094847098 12:34366116-34366138 GAGAGAAGGAAGGCTTGAAATGG - Intergenic
1095231426 12:39744524-39744546 CAGTGATATAAGGGATGGAAGGG + Intronic
1096069717 12:48768235-48768257 CAGACAGGGAAGGGTAGGCATGG + Exonic
1096078634 12:48819502-48819524 CAGAGATGGAGGGGGTGGAAGGG - Intronic
1096243431 12:49971613-49971635 GAGGGATGGGAGGCTTGGAAGGG + Intronic
1096799715 12:54102080-54102102 CAGAGATGGTAAGAGTGGAAAGG - Intergenic
1096995600 12:55836089-55836111 CAGAGGGGGAAGAGTTAGAATGG - Intronic
1097036635 12:56128747-56128769 CCCAGATGGAAGGGGTGGAAGGG - Intronic
1097039003 12:56143172-56143194 GAGAGATGGCAGGCTTGGAAAGG + Intronic
1097124233 12:56760751-56760773 TGGAGATGGAAGGGATGGGATGG + Intronic
1098409298 12:70163211-70163233 GAGAGATGGAATGGATGGATGGG + Intergenic
1098806888 12:75032162-75032184 CAGACAAGGAAAGGATGGAAAGG - Intergenic
1100274326 12:93058137-93058159 CAGAGAGGGAATGATTGGCAGGG + Intergenic
1100828084 12:98493383-98493405 CAGAGAGGGAAGGGCTGGAGTGG - Intronic
1101422354 12:104559999-104560021 CAGAGACTGAAGGGATGGGAAGG + Intronic
1102640272 12:114360854-114360876 TAAAGTAGGAAGGGTTGGAATGG + Intronic
1103107108 12:118238483-118238505 CAGACATTGAAATGTTGGAAGGG - Intronic
1103639598 12:122338973-122338995 CAAAGAAGGAAGGGTTGTGATGG - Intronic
1103936751 12:124481185-124481207 GAGAGAAGGAAGGGGAGGAAGGG + Intronic
1104611723 12:130234574-130234596 CGGTTATGGAAGGGTAGGAAGGG + Intergenic
1104672925 12:130692764-130692786 GAGACATGGAATGGGTGGAATGG + Intronic
1105721906 13:23124914-23124936 CAGATATGTTAGGTTTGGAATGG - Intergenic
1106158898 13:27183339-27183361 CAGCGATGGGAGGGCTGGGAAGG - Intergenic
1108467378 13:50730196-50730218 CAGAGCTGGAAGAGGTGGAAGGG + Intronic
1108781128 13:53835524-53835546 CAGAGGTGGAGGAGGTGGAAGGG - Intergenic
1108794777 13:54017835-54017857 AAGGGAGGGAAGGGTGGGAAAGG + Intergenic
1108829051 13:54453812-54453834 CAGAGATGGAACAGTTTGGAGGG - Intergenic
1108908708 13:55514584-55514606 AAGAGGTGGAAGAGGTGGAAGGG + Intergenic
1110777155 13:79421538-79421560 TAGAGATGGAAGAGAGGGAAAGG - Intergenic
1110935264 13:81279708-81279730 CAGAGGTGAAAGAGGTGGAAGGG - Intergenic
1112153116 13:96786072-96786094 CAGTGCTGTAAGGGGTGGAAAGG - Intronic
1113004222 13:105680131-105680153 AAGAGAGGAGAGGGTTGGAAGGG + Intergenic
1114499787 14:23160155-23160177 CACAGATGGAAGCCTGGGAAAGG + Intronic
1114758372 14:25284788-25284810 CACAAATGGAAGGGTTGAATAGG + Intergenic
1115342098 14:32303869-32303891 GAGAGAAGGAAGGGATAGAAGGG - Intergenic
1115353665 14:32424427-32424449 CAGAGATGGAAGGGAGGTGAAGG - Intronic
1115657649 14:35459211-35459233 CAGGGATGGAGGGGGTGCAATGG + Intergenic
1115754958 14:36520487-36520509 CAGAGCTGGGAGGATGGGAAGGG + Intronic
1116129735 14:40839686-40839708 CAGAAGTGGAGGAGTTGGAAGGG - Intergenic
1116655043 14:47641879-47641901 AAGAGATGCAAGGATAGGAATGG + Intronic
1117613561 14:57508877-57508899 CAGTGATGGAAGGCAGGGAATGG - Intergenic
1117747785 14:58888820-58888842 CAGAGAATGAAGAGTTTGAAAGG - Intergenic
1117752672 14:58939662-58939684 CTGAGATGGGAGGGATGGAGTGG + Intergenic
1119540454 14:75434724-75434746 CAGAGATGGAAGGCTTAGGCAGG + Intronic
1120292392 14:82591539-82591561 CAGACATTGGAGGCTTGGAAGGG + Intergenic
1120434404 14:84462666-84462688 AAGAGATGGAAAGGTTAAAAAGG + Intergenic
1121111585 14:91316705-91316727 CAGAAATGCAAGGGTTGGCCGGG - Intronic
1121242554 14:92440849-92440871 CAGAGAGGGAAGGGAAGGGAAGG + Intronic
1121991751 14:98564454-98564476 TAAAGATGGATGGTTTGGAAGGG - Intergenic
1122526762 14:102391687-102391709 CAGAGAGGGGAGGGCAGGAAAGG - Intronic
1125114789 15:36077433-36077455 CAGAGGTGGAAATGTTGGATGGG + Intergenic
1125797037 15:42410670-42410692 CTGAGAAGGAAGGGGTGGCAGGG + Intronic
1125810690 15:42538585-42538607 CAGAAATAGAAGGCTTGGAGTGG - Exonic
1126747696 15:51843136-51843158 CAGAGTTGGAAGAGCTAGAAAGG + Intronic
1127830640 15:62747988-62748010 CAGAGGTGGAAGAGGTGGAAGGG + Intronic
1127907333 15:63385568-63385590 CAGAGATGGAGAGGTTAAAATGG + Intergenic
1128265430 15:66262331-66262353 GAGAGAGGAAAAGGTTGGAAAGG + Intergenic
1128660915 15:69500390-69500412 CAGAGATGGAGGTGTGGGCAGGG + Intergenic
1128697601 15:69780340-69780362 GAGAGATAGTAGGGTTTGAAAGG - Intergenic
1128983018 15:72199938-72199960 CTCAGATGGCAGGGTTGGCAGGG + Intronic
1129923941 15:79345294-79345316 CAGAGGGTGAAGGGTGGGAAGGG - Intronic
1130670551 15:85908671-85908693 CAGAAATGGAAGTGAGGGAAAGG + Intergenic
1130770040 15:86915220-86915242 CAGGGATGAAAGGGTTGGAAAGG - Intronic
1130989700 15:88869032-88869054 CAGAAATGGAGAGGTTGGCAAGG - Intronic
1131135526 15:89931953-89931975 CAAAGGTGGAAGAGGTGGAAGGG + Intergenic
1131532505 15:93205789-93205811 GAGAGATGAAAGTGTGGGAAAGG - Intergenic
1132020732 15:98359734-98359756 AAGAGGTGGAAGAGTTGGAAGGG + Intergenic
1132300430 15:100771954-100771976 CAGAGCTGGCAGGGTTGGCAGGG + Intergenic
1133261858 16:4556103-4556125 CACATATGGAAGGGATGGAGAGG - Intergenic
1133403552 16:5505899-5505921 CAGGGATGGAAGGGTGAGAGTGG - Intergenic
1133675805 16:8070648-8070670 CAGAGATGGGAAGATTTGAAGGG - Intergenic
1134268195 16:12709874-12709896 CAGGGAAGGAAGGGAAGGAAGGG + Intronic
1134336141 16:13301222-13301244 CAGAGGAGAAAAGGTTGGAAAGG + Intergenic
1134428551 16:14178206-14178228 CAAAGATGGAAGGATGGGAGTGG + Intronic
1135120631 16:19763388-19763410 CAGAGGTGGCAGAGGTGGAAGGG + Intronic
1135404948 16:22190974-22190996 CAAACATGGAAGGGCGGGAAGGG - Exonic
1135573635 16:23568130-23568152 CAGAGAGAGTAGGGGTGGAAGGG - Intronic
1135798163 16:25466008-25466030 CAGAGATCAAAGTGTTGGCAGGG - Intergenic
1135889594 16:26345240-26345262 CAGAGAAGGAAGGGATGGAAAGG + Intergenic
1136345276 16:29671506-29671528 AAGAGAAGGAAGGGATGCAAGGG - Intronic
1136367258 16:29814493-29814515 GAGGAATGGAAGGGTTGGCAAGG + Exonic
1138035119 16:53596613-53596635 CAGAGGTGGCAGCTTTGGAAAGG - Intergenic
1138423440 16:56914809-56914831 TAGAGATGGCAAGGTTGGCAAGG + Exonic
1138876340 16:60955337-60955359 AAGAGGTGGTAGGGCTGGAATGG + Intergenic
1140791804 16:78399082-78399104 GATGGATGGAAGGGGTGGAAGGG + Intronic
1141212048 16:81990513-81990535 GAAAGATGGAAGGGTTTGGAGGG - Exonic
1141287608 16:82687211-82687233 CAGTGATGGAAGGTGTGTAAAGG + Intronic
1141498348 16:84425890-84425912 CAGAATAGGAAGGGTTGGGAAGG + Intronic
1142706016 17:1694913-1694935 CGGAGATGGAAAGGATGGATGGG + Intergenic
1143005663 17:3831707-3831729 CAGAGAAGGAAGGGAAAGAAGGG - Intronic
1143327393 17:6108440-6108462 CAGAGAAGGAAGAGATGAAAAGG + Intronic
1143410322 17:6704603-6704625 GGGAGATGGCAGGGTTGGAGTGG - Intronic
1143733054 17:8892007-8892029 CAGTGATGGAGGGGTTGGCATGG - Intronic
1144341991 17:14317728-14317750 CAGAGGTGGAGAGGCTGGAATGG + Intronic
1144736570 17:17558978-17559000 CAGAGAGAGCAGGGTTGGGATGG - Intronic
1145281084 17:21467551-21467573 CATAGAGGGAAAGGTTGGAAAGG + Intergenic
1146537455 17:33665406-33665428 CACAGAGGGTAGGGTAGGAATGG + Intronic
1146671445 17:34740835-34740857 CAGAAATGAAAGGGTGGGAGGGG + Intergenic
1146741405 17:35287055-35287077 CAGGGAGGAAAGGGTGGGAAGGG - Intergenic
1147141578 17:38463452-38463474 CAGAGAAGGAAGTGTTTGGAGGG + Intronic
1147305965 17:39564548-39564570 TAGAGGTGGGAGGGTAGGAAAGG - Intronic
1147772732 17:42878910-42878932 TAGATAGGGAAGGTTTGGAAAGG + Intergenic
1147952326 17:44114140-44114162 AAGAGATTGAAGGCTTAGAATGG - Intronic
1148735000 17:49860386-49860408 CAGAGATGGAACTGTGGGGAGGG + Intergenic
1149477771 17:56977798-56977820 AAGAGATGGGAGGGGTAGAAAGG + Intergenic
1150343632 17:64387830-64387852 CTGAGATGGAAGGAAGGGAAAGG + Intronic
1150424836 17:65069007-65069029 TAGGGATGGAAGGGCTGGGAGGG - Intergenic
1150892380 17:69167928-69167950 AAGAGGTGGAAGAGGTGGAAGGG - Intronic
1151166992 17:72212403-72212425 AAGAGATGGGAGAGATGGAAAGG + Intergenic
1152774406 17:82191531-82191553 CAGAGGTGGAGGAGGTGGAAGGG - Intronic
1203178595 17_KI270729v1_random:38508-38530 CACGAATGGAAGGGGTGGAATGG + Intergenic
1203180134 17_KI270729v1_random:50220-50242 CACAAATGGAAAGGGTGGAATGG + Intergenic
1153310304 18:3671083-3671105 CAGAGATGGAGGGGAGGGGAGGG - Intronic
1153741928 18:8138386-8138408 CACAGAAGACAGGGTTGGAAGGG - Intronic
1154112303 18:11580462-11580484 AAGATAGGGAAGGGCTGGAAGGG - Intergenic
1154243884 18:12678190-12678212 CAGAGGTGGAAAGGGAGGAAGGG + Exonic
1155358444 18:24977093-24977115 GTGAGAGGGAAGGGATGGAAAGG - Intergenic
1156114392 18:33769684-33769706 GAGAGAAGGAAGGGTTGAATAGG - Intergenic
1156174373 18:34525350-34525372 GAGAGATGGAAGAGTCTGAAGGG - Intronic
1156376747 18:36521562-36521584 CAGAGATGGAAGGACTTGAAAGG - Intronic
1156454414 18:37284997-37285019 CAGAGATGGAGGGGTGGAGAGGG - Intronic
1156498641 18:37543009-37543031 CAGAGATTGAAGAGTTAAAATGG - Intronic
1157174205 18:45436400-45436422 CACAGAGGGAAGAGCTGGAAAGG + Intronic
1157398783 18:47368278-47368300 CAGAGATGGAGGAGGTAGAAGGG + Intergenic
1157501074 18:48191136-48191158 CAGAGGTGGGAGGGTAGGAACGG + Intronic
1157831365 18:50859769-50859791 AGGAGATGGAAGGGTAAGAAGGG - Intergenic
1158920537 18:62187076-62187098 CAGAGAAGGAAGGCGTGGAGCGG - Intronic
1159766328 18:72493291-72493313 CAGAGAAGGAATGGTTTGGAAGG + Intergenic
1160409846 18:78667967-78667989 AAGAGATGGAAGGGTGGCTAGGG - Intergenic
1160509288 18:79444345-79444367 CAGAGAAGGAACGGGAGGAACGG - Intronic
1160686491 19:439170-439192 CAGAGAGGGAGGGGTGGGAGAGG + Intronic
1160793348 19:933015-933037 CAGAGATGGAAAGGTGGGCCTGG + Intronic
1161145923 19:2678031-2678053 CACAGGTGGCAGGGTTAGAAAGG - Intronic
1162190060 19:8937937-8937959 CAGAGTTGGAAGAGTTGTACTGG + Exonic
1162788330 19:13050178-13050200 CAGTGATGGAAGGGTCAGCAGGG - Intronic
1162804456 19:13129802-13129824 CAGAGATGTGGGGGTTGGGAAGG - Intronic
1162858293 19:13486800-13486822 CAGAGATGGAAGGGGAGAGAAGG - Intronic
1162941580 19:14013374-14013396 CAGTGGGGGAAGGGTGGGAAGGG + Intergenic
1163163901 19:15482277-15482299 CAGAGGTGGAAGAGGAGGAAGGG - Intronic
1163715601 19:18870483-18870505 CAGAGTTGGAGGGGGTGGAGGGG + Exonic
1164755411 19:30685520-30685542 TAGAGACGGAAGGGATGGATTGG + Intronic
1165185392 19:34016352-34016374 CACAGATGGAAGGATTTGGAGGG - Intergenic
1165793516 19:38506014-38506036 CAGACAGGGAAGGGATGGAGAGG + Intronic
1165956557 19:39504984-39505006 CAAAGATGTAGGGGTGGGAATGG + Intronic
1166212528 19:41316335-41316357 CAGAGATGGGAGTGTGGGAAGGG - Intronic
1166277334 19:41763123-41763145 CACACGTGGAAGGGTTGAAAAGG - Intronic
1166419418 19:42625035-42625057 CAGAGATGCATGGGAGGGAAAGG - Intronic
1166593924 19:44027631-44027653 AACAGATGGCAGGGTGGGAAGGG - Intronic
1166661316 19:44649118-44649140 CGGAGAGGGCAGGGCTGGAAAGG - Intronic
1167758219 19:51426544-51426566 CGGGGATGCAAGGGTTGGCAGGG + Intergenic
925106876 2:1299339-1299361 CTGAGATCAAAGGGTTGGCAGGG + Intronic
926299199 2:11590113-11590135 CTGAGATGGAATGGGTGGGAAGG + Intronic
926705738 2:15836130-15836152 CAGAGATGGAAGGGAGGGGCAGG + Intergenic
927018050 2:18988080-18988102 CAGAAAAGGAGGGTTTGGAATGG - Intergenic
927559515 2:24059965-24059987 CACAGAGGGAAGGGAAGGAAGGG + Intronic
927579336 2:24227628-24227650 CAGAGATGGAAGGCTGGGCATGG + Intronic
928090135 2:28368870-28368892 CAGAGCTGGAAGGGACAGAAAGG - Intergenic
928644581 2:33338724-33338746 CAGAGACGGAAGGAGTGGCATGG + Intronic
929161413 2:38836275-38836297 CAGAGGTGGAAGAAGTGGAAGGG - Intronic
929193822 2:39164880-39164902 CAGAGATAGAAGAGTTGGCTGGG - Intergenic
929391640 2:41475191-41475213 CAAAGAAGGAAAGGCTGGAAGGG - Intergenic
929666861 2:43840102-43840124 CAAAGATGGAAAGGTAGGATGGG - Intronic
931391327 2:61846402-61846424 CAAAGATGAAAGGGTTGGGTGGG + Intronic
933331283 2:80895984-80896006 AAGACATGGAAGGGTTGCATAGG - Intergenic
933337379 2:80975613-80975635 GAGAGAAGGAAGGTTAGGAAAGG - Intergenic
934474965 2:94587669-94587691 CAGAGATGGCAGGGATGCACTGG + Intergenic
935283996 2:101547352-101547374 CAGAAAGGGAAGGATTGGGAAGG - Intergenic
935319467 2:101871784-101871806 CAGAGAAAGCAGGGTGGGAAGGG - Intronic
935347678 2:102123946-102123968 GAGAGGTGAAAGGGATGGAAAGG + Intronic
935803395 2:106722676-106722698 AAGAGATGGAGGAGATGGAAGGG + Intergenic
936484789 2:112916581-112916603 CGGTGATGGAAGAGTTGGGAGGG - Intronic
936618590 2:114072864-114072886 CAGAGAGGCAAGGGAAGGAAAGG - Intergenic
937496875 2:122429593-122429615 TAGAGAAGCAAGGTTTGGAAGGG - Intergenic
938222720 2:129585365-129585387 CAGTGCTGGAATGATTGGAAAGG + Intergenic
939789407 2:146553010-146553032 AAGAGAGGAGAGGGTTGGAAAGG + Intergenic
939903521 2:147880890-147880912 CAGGGGTGGAAGGGCTAGAAAGG + Intronic
939908134 2:147944186-147944208 AAGAGAAGGAAGGGTTTGAAAGG + Intronic
940340043 2:152570666-152570688 CTGAGATGTGAGGATTGGAAAGG - Intronic
941368801 2:164638623-164638645 CAGAGAAGGCGGGGTTGGAGAGG + Intergenic
941625642 2:167827580-167827602 CAGAGAGGGAAGGGGTGGGGTGG - Intergenic
941860285 2:170272318-170272340 CAGTAACAGAAGGGTTGGAAAGG - Intronic
942166282 2:173243960-173243982 CAGAGAAGGATGAATTGGAAAGG + Intronic
942927115 2:181447120-181447142 ACCAGATGGAAGAGTTGGAATGG - Intergenic
943682356 2:190781842-190781864 CAGGGCTGGAAGGGTTGGGGTGG - Intergenic
943901380 2:193442089-193442111 CAAAGATGGAAGGGGGAGAAAGG - Intergenic
944325949 2:198404113-198404135 CAGAGAGAAAGGGGTTGGAAGGG - Intronic
944414099 2:199466539-199466561 GAAAGATGGAAGGATTGGCAAGG + Intronic
944651172 2:201831645-201831667 CAGAGAGGAAAGGGGTTGAATGG + Intronic
944663958 2:201943906-201943928 CAGAGATGGAGGAGGTGGAAGGG + Intergenic
945997806 2:216453617-216453639 CTGAGTTGGAAGGGTTAAAATGG + Intronic
946060831 2:216940097-216940119 CAGAGATGTAGGTGTTGGTAGGG + Intergenic
947759176 2:232590957-232590979 CAGAGATAGGAAAGTTGGAAAGG - Intergenic
947870674 2:233436169-233436191 CAGTGAGGGAAGGGATGGCAGGG - Intronic
948283770 2:236768807-236768829 CACAGAAGGAAGGGCTGGGATGG - Intergenic
948294860 2:236853103-236853125 CAGAAAGGGAAGAGTTGGACTGG - Intergenic
948538320 2:238664591-238664613 CAGAGAAGGAAGAGTGGGAGGGG - Intergenic
948606907 2:239141595-239141617 CAGAGATGGGAGAGTTGGAGGGG - Intronic
948855630 2:240729295-240729317 CGGAGATGGAAGAGAAGGAAGGG - Intronic
1168875652 20:1170546-1170568 CAGAAAAGGAAGGATTGGGAAGG + Intronic
1168881413 20:1209394-1209416 TGGAGATGGAGGGGTTGGCAGGG - Intergenic
1169837937 20:9901208-9901230 AAGGGATGGAAGAGATGGAAAGG + Intergenic
1170327369 20:15171403-15171425 GAGAGATGGAAGGGGAGAAATGG - Intronic
1171101491 20:22387950-22387972 CAGAGAAAGCAGGGTTGGTAAGG + Intergenic
1171150884 20:22825686-22825708 GAGTGATGGAAGTGATGGAATGG - Intergenic
1171851524 20:30311899-30311921 CAGAGATGGTAAGAGTGGAAAGG - Intergenic
1171960130 20:31487446-31487468 CAGAGAGGACAGGATTGGAAGGG - Intergenic
1172031382 20:31984477-31984499 CAGAGTTGGATGGGTGGGGAGGG + Intronic
1172432214 20:34901675-34901697 CAAAGTTGGAAGGGCTGTAAAGG + Intronic
1172474026 20:35223984-35224006 CAAAGTTGGAAGGTTTGGGAGGG - Intergenic
1172577396 20:36019706-36019728 CTGAGATGGAGGGCTTGGAAGGG + Intronic
1172588132 20:36099306-36099328 CAGAGAAGGGAGAGCTGGAAAGG - Intronic
1172844645 20:37922658-37922680 CAGAGATTTGAAGGTTGGAAGGG + Intronic
1173410830 20:42808206-42808228 CAGCTATGGAAGGGAAGGAAGGG - Intronic
1175076458 20:56378866-56378888 CAGAGATGGAAGGGTTGGAAGGG + Intronic
1175473569 20:59252159-59252181 AAAAGATGGATGGGTTGGCAGGG + Intronic
1175578489 20:60080437-60080459 GAGAGAGGGAAGGGGCGGAAGGG + Intergenic
1175830656 20:61963608-61963630 AAAAGATGTAAAGGTTGGAAGGG + Intronic
1176128727 20:63487345-63487367 CAGAGCAGGGAGGGGTGGAAAGG + Intergenic
1177527561 21:22314062-22314084 CAGAGATGGGATGATAGGAAGGG + Intergenic
1177567106 21:22838175-22838197 CAGAGGGGGAAGGGAAGGAAGGG + Intergenic
1177732328 21:25043685-25043707 CTGAGATGAAGGTGTTGGAAGGG + Intergenic
1177858777 21:26428449-26428471 CAGAGATGGAAGTGTAGTGACGG + Intergenic
1177954668 21:27582860-27582882 CAGAGCTAGAAGTGTTGGAGTGG + Intergenic
1177966233 21:27730376-27730398 AAGAGATGGTAGGCTTAGAAAGG + Intergenic
1178099109 21:29247094-29247116 GAAAGGTGGAAGGGTGGGAAGGG - Intronic
1178390605 21:32194887-32194909 CAAAGGTGGGAGGGTGGGAAGGG + Intergenic
1178667157 21:34558311-34558333 CAGAGATGGAAAGGTTTGCCAGG + Intronic
1178794148 21:35728105-35728127 CAGAGATGGAGGAGGTGGAAGGG - Intronic
1179241792 21:39599360-39599382 CAGAGAGGCCAGGGATGGAAGGG - Intronic
1180392066 22:12293488-12293510 GAGAGAGGGAAGGTTAGGAAAGG - Intergenic
1180407678 22:12571268-12571290 GAGAGAGGGAAGGTTAGGAAAGG + Intergenic
1181247255 22:21511901-21511923 CAGAGAAGGAAGAGTGGGAGGGG - Intergenic
1181522458 22:23457472-23457494 CAGAGATGGCAGAGATGGATGGG + Intergenic
1181546236 22:23604114-23604136 CAGAGTTGGATGGGTGGGCAGGG - Intergenic
1181931198 22:26402985-26403007 CAGAGAAGTGAGGCTTGGAAAGG - Intergenic
1182917059 22:34043697-34043719 CAGAGATGGGAGCAGTGGAATGG + Intergenic
1182945713 22:34319638-34319660 CAGAGATGGAGAAGTGGGAAAGG + Intergenic
1183629831 22:39026258-39026280 CAGAGAGGACAGGGCTGGAAGGG - Intronic
1183633269 22:39046117-39046139 CAGAGAGGACAGGGCTGGAAGGG - Intronic
1183751844 22:39725360-39725382 CAGAAATGGCAGAGTTGGAAGGG + Intergenic
1183908176 22:41058678-41058700 CAGAGAAAACAGGGTTGGAAAGG - Intergenic
1185285014 22:49996231-49996253 CAGAGGTGGGAGGGGTGGGAGGG - Exonic
1203308214 22_KI270736v1_random:124426-124448 TAGAGATGAAAGGAATGGAAGGG + Intergenic
950223357 3:11213589-11213611 CTGTGATGGAAGAGGTGGAAGGG + Intronic
950447214 3:13045215-13045237 CAGAGATGGGAGGGTGGCCAGGG - Intronic
952096089 3:29956262-29956284 CAGAGATGGCAGGTGTGGCAGGG - Intronic
952282602 3:31938140-31938162 AAGAGATGGAAGAGTTGGTGTGG - Intronic
952356860 3:32592647-32592669 CAGAAAAGGAAGGGAAGGAAGGG - Intergenic
952370806 3:32720969-32720991 AAGAGAAGGAAGGGAAGGAAAGG - Intronic
952388485 3:32860156-32860178 CAGAGAGGGAAGGGGAGGAGAGG - Intronic
952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG + Exonic
953233325 3:41084276-41084298 CAGGGATGGAGGGGTAGGAGTGG - Intergenic
954602897 3:51884825-51884847 TGGAGTTGGAAGGGTGGGAAAGG + Intergenic
954696267 3:52428752-52428774 CAGACCTGGAAGGCTGGGAAAGG + Intergenic
954972279 3:54661246-54661268 CATAGAAGTAAGGGTTGAAAGGG - Intronic
958601870 3:96305014-96305036 AAGAGATGGATATGTTGGAAGGG + Intergenic
961009098 3:123424190-123424212 CTGAGATGGAATGGTGGGCAGGG + Intronic
961062738 3:123845219-123845241 CAGAGATCTTAGAGTTGGAATGG - Intronic
961317964 3:126053339-126053361 CTGAGATGAAAGTGTTGGCAGGG - Intronic
962569565 3:136699062-136699084 CAGTGGAGGAAGGTTTGGAAGGG + Intronic
962943637 3:140148048-140148070 CTGAAATGGAAAGGGTGGAAAGG + Intronic
963168673 3:142229961-142229983 CAGAAATGGGAGGGTGGGACGGG + Intergenic
963912969 3:150830806-150830828 CAGAGATGATGGGGTTGGGAAGG - Intergenic
965069449 3:163899635-163899657 AAGAGATGGAGGAGGTGGAAAGG - Intergenic
967313709 3:188130771-188130793 CAGAGGTGAAAGAGGTGGAAGGG + Intergenic
967432872 3:189407456-189407478 CAGACATGTAAGGTTTGGAGAGG - Intergenic
967567298 3:190987629-190987651 CAGAGATGGAACAGTTTGGAGGG + Intergenic
967999188 3:195191238-195191260 CAGAGGTGGAGGAGGTGGAAGGG - Intronic
969288910 4:6226243-6226265 CAGATATGAAATGGATGGAAGGG + Intergenic
969434816 4:7182766-7182788 CAGAGAAGGACGGGATGAAATGG - Intergenic
969435118 4:7184921-7184943 AAGAGAGGGAAATGTTGGAAGGG - Intergenic
970204804 4:13645177-13645199 CAGAGAACACAGGGTTGGAAGGG + Intergenic
970462389 4:16288044-16288066 CAAGGATGGCAGGGTTGGAGAGG + Intergenic
970734415 4:19149289-19149311 GAACAATGGAAGGGTTGGAAAGG - Intergenic
971055725 4:22910569-22910591 GAGAGAAGGAAGGGGAGGAAGGG + Intergenic
972694040 4:41427217-41427239 GAGAGAGGGAAGGGGTGGGAAGG - Intronic
974068558 4:57103135-57103157 CAGAGAGGGAAGTCTTGGGAAGG + Intronic
974853278 4:67429031-67429053 CTGAGATCAAAGTGTTGGAAGGG - Intergenic
978297432 4:107222782-107222804 CAGAGATATAAGGATTGGAAAGG - Intronic
978406358 4:108383213-108383235 CAGGGATGGAAATCTTGGAAAGG + Intergenic
978623208 4:110655200-110655222 CAGAAATGAAAGTGTTGGCAGGG - Intergenic
979260518 4:118638859-118638881 CAGAGAAGGGGGGGTTGGAGAGG + Intergenic
981852948 4:149252966-149252988 CATTGAAGGAAGGGTTGGATTGG - Intergenic
982226835 4:153174320-153174342 GAAAGAGGGAAGGGATGGAAAGG - Intronic
982421968 4:155208761-155208783 CAGAGATGGGAGCGTGGGGAGGG - Exonic
982523094 4:156444762-156444784 CAGAGAAAGAAGGGGAGGAAGGG + Intergenic
983076490 4:163332517-163332539 TAAAGAAGGAAGGGTGGGAATGG + Exonic
984019714 4:174470299-174470321 AAGAGATGGAGGAGGTGGAAGGG + Intergenic
984190874 4:176604322-176604344 AAGAGGTGGAGGAGTTGGAAGGG + Intergenic
984251827 4:177345109-177345131 CCGTGATGGAAGTGTTGTAAAGG + Intronic
984550721 4:181155700-181155722 CAGAAATCGAAGGTGTGGAAAGG - Intergenic
984870220 4:184318563-184318585 CAGAGATGGCAGAGATGGCATGG - Intergenic
985353761 4:189095693-189095715 CAGAGAAGGACGAGCTGGAAAGG + Intergenic
985795340 5:1957964-1957986 CAGAGATGGAGGGATTGGTGAGG + Intergenic
986152974 5:5144763-5144785 CAGAGACAGAAGGGTGGGACAGG - Intronic
986763168 5:10898386-10898408 CAGAGGTGGAGGAGGTGGAAGGG + Intergenic
986826411 5:11527470-11527492 TAGAGGTGGATGGGTGGGAAGGG - Intronic
987415502 5:17657401-17657423 CTTAGATGGAAGGGTGGAAAGGG - Intergenic
987762592 5:22184997-22185019 CAGAGAGGGTAGGGTGGGAGAGG - Intronic
988458851 5:31413983-31414005 CAGTGAGAGAAGGGTGGGAAAGG + Intronic
988844628 5:35115632-35115654 TGGAGGTGGGAGGGTTGGAATGG + Intronic
988853082 5:35198031-35198053 AAGAGATTGAAGGGCTGGACTGG - Intronic
989659548 5:43785503-43785525 CAGGGCTGGAAGGGCTGGGAGGG - Intergenic
989807151 5:45623392-45623414 CAGAGATGGAAGTGATGTGAGGG - Intronic
990446147 5:55896495-55896517 AAGGGATGGAAGGGAGGGAAGGG - Intronic
991515980 5:67436006-67436028 CAGAGATGAAAGTGTTGCAGAGG + Intergenic
991897383 5:71418382-71418404 CAGAGAGGGTAGGGTGGGAGAGG - Intergenic
992022374 5:72637172-72637194 AAGAGAAGGAAGGGAAGGAAAGG + Intergenic
992232563 5:74677848-74677870 CAGAAAGGGGAGGGTGGGAAAGG - Intronic
992257316 5:74934045-74934067 AAGAGATGGGACTGTTGGAAGGG - Intergenic
992317241 5:75569005-75569027 GAGAGATGAAAGGGTTAGTAGGG + Intronic
992387116 5:76295287-76295309 CAGTGGTAGAAGGGATGGAAGGG + Intronic
992396606 5:76374535-76374557 CAAAGTTGGAAGGGCTGGCAGGG - Intergenic
992592344 5:78308373-78308395 CACAGATGGAAGGATTATAATGG + Intergenic
992636335 5:78728988-78729010 CAGAGATGGAGGAGGTGGTAGGG + Intronic
994755329 5:103788024-103788046 CAGAATTGCAAGGGTTGAAATGG - Intergenic
995315590 5:110768370-110768392 CAAAGATGTAAAGGTAGGAAAGG - Intergenic
995397243 5:111700035-111700057 CTAAGATGGAAGGGATGGAGAGG - Intronic
996560516 5:124823580-124823602 CAGAGATGCAAGAGGTGGCAGGG + Intergenic
996714857 5:126579027-126579049 CAGAGATGGGAGGGCTGGAGAGG - Intronic
997218229 5:132132751-132132773 CAGTGATGCAAGGGATGGGAGGG - Intergenic
997391923 5:133524196-133524218 GAGAGATGGACGGGCTTGAACGG + Intronic
998132455 5:139658257-139658279 CATAGATAGAATGCTTGGAATGG + Intronic
998472757 5:142396120-142396142 CAGAGAAGCAAGGGGTGGCATGG + Intergenic
998798398 5:145843109-145843131 CAGATACTGAAGGGTTGGAATGG + Intergenic
999061618 5:148641727-148641749 CAGAAAACCAAGGGTTGGAATGG - Intronic
999101876 5:149032056-149032078 CCTAAATGGAAGGGTTGAAAAGG + Intronic
999174978 5:149625739-149625761 GAGAGGTGGGAGGGTGGGAAGGG - Intronic
1000070841 5:157739620-157739642 CAGGGAAGGAAGGGATGGATGGG + Exonic
1000079961 5:157835638-157835660 CAGAGAAGGGAGAGGTGGAAAGG + Intronic
1000491418 5:161918874-161918896 CAGAGGGGGAAGGGTGGAAAGGG + Intergenic
1000946326 5:167427498-167427520 AAGAGAAGGAAGGGAAGGAAGGG + Intronic
1001275919 5:170351481-170351503 CAGAGACAGAAAGTTTGGAAGGG - Intergenic
1001415747 5:171543890-171543912 CTGAGAAGGAAGGGTAGGGAAGG + Intergenic
1001631599 5:173179491-173179513 CAGAGATAGCAGGGCAGGAATGG - Intergenic
1001884273 5:175274727-175274749 AAGAGATGGAAGGGGTGAGAAGG - Intergenic
1001975934 5:175998341-175998363 CAGAGAAGGAATGATCGGAAAGG + Intronic
1002241492 5:177845431-177845453 CAGAGAAGGAATGATCGGAAAGG - Intergenic
1002320751 5:178374258-178374280 CAGGGATAGAAGGGTTGCAGAGG - Intronic
1002401163 5:178992208-178992230 GGGAGATGGAAGGGTTGGGGTGG + Intronic
1002783440 6:384004-384026 CAGGGAAAGAAGGGTTGGCAAGG - Intergenic
1002791409 6:440588-440610 ATGAGATGGAAGGGATGGTAAGG - Intergenic
1002791428 6:440654-440676 AAGAGATGGAAAGGATGGGATGG - Intergenic
1003683623 6:8279681-8279703 CAGAGAAGGAAGAGATAGAAAGG - Intergenic
1004064241 6:12227448-12227470 CAGTTATGAGAGGGTTGGAAGGG + Intergenic
1004069636 6:12287212-12287234 CAGAAAGGGAAGGGAAGGAAGGG - Intergenic
1004252126 6:14031586-14031608 GAGAAATGGATGAGTTGGAAGGG - Intergenic
1004392461 6:15221113-15221135 CAGAAGTGGATGGGTTTGAAAGG + Intergenic
1004834186 6:19512466-19512488 AAGAGGTGGAAGAGGTGGAAGGG - Intergenic
1004918533 6:20355067-20355089 AAGAGGTGGAAGAGGTGGAAGGG - Intergenic
1005565669 6:27091606-27091628 CATAAATGAAAGGGTTGGAAAGG - Intergenic
1006575142 6:35039710-35039732 TAGAGAAGGAAGGGTGAGAAAGG + Intronic
1006827772 6:36948733-36948755 GAGAGAAGGAAGGGAAGGAAGGG - Intronic
1007206047 6:40152120-40152142 CAGAAATGGAATGGTTAAAAAGG + Intergenic
1007303228 6:40884455-40884477 AAGAGATGGGAAGGATGGAAAGG + Intergenic
1008220365 6:48846519-48846541 CAGGGATGGAGGGGTTGAAAAGG + Intergenic
1008229137 6:48962254-48962276 CAGAGATGCCAGGCCTGGAAAGG + Intergenic
1008708916 6:54199649-54199671 GAGAGATGGTTGGGTTTGAAAGG + Intronic
1009427528 6:63530891-63530913 CAGAGATGTAATGATTAGAATGG + Intronic
1011106625 6:83788888-83788910 CAGAGAATGAAGGGTGGGGAAGG - Intergenic
1011566486 6:88678977-88678999 AAGAGGTGGAAGAGGTGGAAGGG - Intronic
1011981713 6:93386863-93386885 CACAGATGGAAGGGCTGGGATGG + Intronic
1013012671 6:106134391-106134413 CAGCCATGGAAGTGTTGGGATGG + Intergenic
1013653002 6:112215136-112215158 CGGAGATGGAAGCATTAGAAAGG + Intronic
1013791926 6:113847201-113847223 AAGAGAAGGAAGGGAAGGAAAGG + Intergenic
1013851693 6:114523696-114523718 CAGAGACAGAAGGGATGGAATGG + Intergenic
1013929511 6:115514318-115514340 CAGAAAAGGAAGGTTGGGAAGGG - Intergenic
1014245796 6:119067243-119067265 CTCAGATGAAAGGGGTGGAAAGG - Intronic
1014616175 6:123602420-123602442 CACAGAGGGAAGGGTTGTAGGGG + Intronic
1015481806 6:133720132-133720154 CAGAGCTGGAAAGCTTGGATTGG - Intergenic
1015527483 6:134187427-134187449 CAGAAATGGAAGGGGTGGAAGGG - Intronic
1015767754 6:136737233-136737255 TAGAGACGGGAGGGTGGGAAGGG + Intronic
1015893979 6:137998602-137998624 CAGAGAAGAGAGGGTGGGAAGGG + Intergenic
1016133561 6:140508237-140508259 CAGAGATGGAAGCGGTGGAATGG + Intergenic
1017378107 6:153795014-153795036 AGGAGATGGAAGGGAAGGAAGGG + Intergenic
1017829301 6:158111153-158111175 CACAGAAGGAAGGGCTGGATTGG - Exonic
1017923111 6:158888221-158888243 AAGAGAGAGAAGGGTGGGAAGGG + Intronic
1018661059 6:166087762-166087784 CAGGCATGGATGGGGTGGAATGG - Intergenic
1019594836 7:1853716-1853738 CGGGGATGGAAGGGTGGGACAGG - Intronic
1020423679 7:8039623-8039645 GAGACTTGGAAGGGTTGGAGTGG + Intronic
1020622727 7:10537245-10537267 CAGAGTTGTAGGGGGTGGAAAGG - Intergenic
1021161014 7:17272693-17272715 CAGAGGCAGAAGGCTTGGAAAGG - Intergenic
1021746737 7:23748536-23748558 CAGAGAGGGAAGAAGTGGAAGGG - Intronic
1022067008 7:26869017-26869039 CAGAGATGGAGGGTGTGGCAGGG - Intronic
1022309847 7:29186556-29186578 CAGAGATGAAAGGAAAGGAAAGG + Intronic
1022574288 7:31482633-31482655 CAGAGATGCAAGACTTGGCAGGG + Intergenic
1023102089 7:36728168-36728190 GAGACTTGGAAGGGTGGGAAAGG - Intergenic
1023115692 7:36859889-36859911 GAGAGGTGGAAGAGGTGGAAGGG - Intronic
1023210783 7:37802825-37802847 AAGAAAGGGAAGGGATGGAAAGG - Intronic
1024076212 7:45819092-45819114 CAGAGAAGGAGGGGTTGGAGAGG + Intergenic
1024229022 7:47350099-47350121 AAGGGATGGAAGGGAAGGAAAGG - Intronic
1025128191 7:56362360-56362382 CAGAGAAGGAAGGGTTGGAGAGG - Intergenic
1025323094 7:58119549-58119571 CACGAATGGAAGGGGTGGAATGG - Intergenic
1026176336 7:68001044-68001066 AAGAGGTGGAAGAGCTGGAAGGG + Intergenic
1026989008 7:74572682-74572704 CAGAGTTGGAAGGGTAGAGAGGG - Intronic
1027978150 7:85185289-85185311 CAGAGAGGGAAGGGTTGAGGCGG - Intronic
1028127031 7:87125368-87125390 CACAGATGGAGTGGTTAGAAAGG - Intergenic
1028575619 7:92346942-92346964 CAAAATTGGAAGGGGTGGAAAGG - Intronic
1029368601 7:100132858-100132880 CAGAGAAGGAAGGGTTTGTCAGG - Intergenic
1029403469 7:100359193-100359215 CAGACATGGAAGGGGTAGCAAGG - Intronic
1029533799 7:101143662-101143684 AAGAGAAGGAAGGGAAGGAAGGG + Intergenic
1029664847 7:101988561-101988583 CAGAGAAGGCAGAGGTGGAAAGG - Intronic
1030318006 7:108136270-108136292 CAGATGTGGGAGGGTTGCAAAGG - Intergenic
1031060702 7:117048207-117048229 CAGAGATGGAGGAGGTGAAAGGG + Intronic
1031209788 7:118808364-118808386 AAGAGATGGAGGAGGTGGAAGGG + Intergenic
1031578607 7:123444941-123444963 CAGAGAAGAAAGGGTTGGGGAGG - Intergenic
1031681602 7:124681423-124681445 CAGAGGTGGAGGAGGTGGAAAGG - Intergenic
1032098713 7:128954819-128954841 AAGAGAAGGAAGGGTAGGAGAGG + Exonic
1032205609 7:129862507-129862529 CAGAAATGGAAAGGTTGGGGCGG + Intronic
1032274115 7:130439878-130439900 TGGAGATGGAAGGGGTGGCAAGG - Intronic
1032345016 7:131109440-131109462 TAGAATTAGAAGGGTTGGAATGG - Intergenic
1032472297 7:132187419-132187441 CAGAGAGGGAAAGGTTAGACAGG - Intronic
1032820141 7:135516874-135516896 CAGAGATCTTAGGGTTGAAAAGG + Intergenic
1034116652 7:148589577-148589599 CAGAGCTGGAGGGGCTGGAGGGG - Intergenic
1035584335 8:760340-760362 GAGAGATGAAAGGGTTAGAAAGG - Intergenic
1035961735 8:4145804-4145826 GAGGAATGCAAGGGTTGGAATGG + Intronic
1036408684 8:8478678-8478700 CAGAGATGGAAGGGGAGGAAAGG + Intergenic
1036439421 8:8767116-8767138 CAGAGATCAAAGTGTTGGCAGGG - Intergenic
1037292526 8:17366448-17366470 CAGAATGGGAAGGGTGGGAAAGG + Intronic
1037918000 8:22784361-22784383 CAGAGAAGGAAGGAAGGGAAGGG + Intronic
1038915491 8:32017057-32017079 CAGAGAGGAAAATGTTGGAATGG + Intronic
1039640553 8:39216487-39216509 CAGAAAGGGAAGGGAAGGAAAGG - Intronic
1040380490 8:46867538-46867560 CAAAGATGGAAAGGTGGTAACGG - Intergenic
1041300645 8:56407786-56407808 CAGAGGGGGAAGGGGTGGAGGGG + Intergenic
1041726199 8:61019875-61019897 CACAGAAGCAAGGCTTGGAAAGG - Intergenic
1042277078 8:67016853-67016875 CAGTGAGGGAAGGTTGGGAAGGG - Intronic
1043484433 8:80685308-80685330 CAGAAATGGAAGGGTATGACAGG + Intronic
1044828725 8:96224245-96224267 CAGAGTGGGGAGGGATGGAAGGG + Intergenic
1045061529 8:98415499-98415521 TAGAGATGGAGTGGTTGGGAAGG - Intronic
1045287070 8:100801050-100801072 CATAGGTGGTAGGGTTGGAGAGG - Intergenic
1046515706 8:115256945-115256967 CAGGGAGGGAAGGAATGGAAAGG + Intergenic
1046758908 8:118000208-118000230 GACAGATGGAAGGGAGGGAAGGG + Intronic
1047493122 8:125390439-125390461 CAGAGCTGGCAGGGTGGGCAGGG - Intergenic
1047514449 8:125541411-125541433 TGGGGATGGAAGGGTGGGAATGG + Intergenic
1048258430 8:132923956-132923978 CAGAGGTGGCAGGGTGGGGATGG + Intronic
1051482382 9:17574679-17574701 GAGAGAAGGAAAGGTGGGAAAGG + Intergenic
1051869471 9:21720208-21720230 CAGAGCTGGAAGGGTTACCAAGG - Intergenic
1051952894 9:22658504-22658526 AAGAAATGGAAGGGAAGGAAAGG - Intergenic
1052046519 9:23800205-23800227 CAGACATCGAAGGCTTGGATAGG + Intronic
1052317782 9:27133919-27133941 CAGAGCTGGAAGTGATGGATAGG + Intronic
1052971325 9:34378880-34378902 CTGAGATGATGGGGTTGGAAGGG + Intergenic
1053035860 9:34826353-34826375 CATAGATGGAAGGGCCAGAATGG - Intergenic
1053459124 9:38254958-38254980 GAAAGATGGCAGGGCTGGAATGG - Intergenic
1053683107 9:40498432-40498454 CAGAGATGGCAGGGATGCACTGG - Intergenic
1053789299 9:41675154-41675176 CAGAGATGGTAAGAGTGGAAAGG - Intergenic
1053933087 9:43126748-43126770 CAGAGATGGCAGGGATGCACTGG - Intergenic
1054155841 9:61639609-61639631 CAGAGATGGTAAGAGTGGAAAGG + Intergenic
1054177581 9:61886507-61886529 CAGAGATGGTAAGAGTGGAAAGG - Intergenic
1054280607 9:63126496-63126518 CAGAGATGGCAGGGATGCACTGG + Intergenic
1054296207 9:63333930-63333952 CAGAGATGGCAGGGATGCACTGG - Intergenic
1054394223 9:64638435-64638457 CAGAGATGGCAGGGATGCACTGG - Intergenic
1054428873 9:65143634-65143656 CAGAGATGGCAGGGATGCACTGG - Intergenic
1054475611 9:65570609-65570631 CAGAGATGGTAAGAGTGGAAAGG + Intergenic
1054501506 9:65877901-65877923 CAGAGATGGCAGGGATGCACTGG + Intronic
1054659950 9:67694301-67694323 CAGAGATGGTAAGAGTGGAAAGG + Intergenic
1054748346 9:68878895-68878917 CAGGGGGTGAAGGGTTGGAAGGG + Intronic
1056155933 9:83837785-83837807 CAGAGAAGGCAGGCATGGAAAGG - Intronic
1056354602 9:85785779-85785801 CAGAGAAGGCAGGCATGGAAAGG + Intergenic
1057292089 9:93813263-93813285 ATGAGATGGAATGGATGGAATGG + Intergenic
1057750484 9:97788738-97788760 GAGAGTTGGAAGGGTGGGAGGGG - Intergenic
1057750489 9:97788747-97788769 CAGACATTGGAGAGTTGGAAGGG - Intergenic
1057759223 9:97859319-97859341 CAGAGAGGGCAGGGTGGCAAGGG + Intergenic
1058240117 9:102547583-102547605 CAGAGATGGAACAGTTTGGATGG + Intergenic
1058524003 9:105839143-105839165 CAGAGATTGGAGGGTGTGAAGGG + Intergenic
1059454030 9:114388427-114388449 CAGAGCTGGAAGGGCAGGAGTGG - Intronic
1059460605 9:114427340-114427362 CAGAAATAGAAGGGGTTGAAAGG + Intronic
1059969781 9:119653826-119653848 CAGAGATGGAAAATTTGGTATGG + Intergenic
1060452415 9:123755608-123755630 CAGAGGTGGAAGAGGTGGAAGGG - Intronic
1060591029 9:124817062-124817084 GAGAGATGGAATGGATGGAAAGG + Intergenic
1061078042 9:128353559-128353581 CAGAGAGGGAGGGGTTGGCCTGG + Intronic
1061127378 9:128685423-128685445 CAGGACTGGAAGGGATGGAAAGG + Intronic
1061393643 9:130331641-130331663 GAGAAATGAAAGGGTTGGACAGG + Intronic
1061807748 9:133145864-133145886 TAGAGATGGAAGGATTAGGAAGG + Intronic
1062212706 9:135373213-135373235 CAGACAGGGAAGGGGCGGAAGGG + Intergenic
1062718742 9:138023835-138023857 CAGGGAGGGAAGGGTTGGCCGGG + Intronic
1203722052 Un_GL000216v2:20618-20640 CACGAATGGAAGGGGTGGAATGG - Intergenic
1203723421 Un_GL000216v2:30247-30269 CACGAATGGAAGGGGTGGAATGG - Intergenic
1203723443 Un_GL000216v2:30396-30418 CACGAATGGAAGGGGTGGAATGG - Intergenic
1186051740 X:5604008-5604030 CAGAGATGTGAGGGTTATAAGGG + Intergenic
1186348219 X:8716530-8716552 CAGAGATGTAAGCATAGGAAGGG + Intronic
1186367268 X:8908871-8908893 CAGGGATGGACAGGATGGAAGGG + Intergenic
1186507310 X:10103380-10103402 GACAGATGGAAGGCTAGGAAGGG + Intronic
1186713824 X:12229467-12229489 AAGAGATGCAAGGGTAGGAAGGG - Intronic
1187250708 X:17595508-17595530 TTGAGAGGGAAGGGTTGGACAGG - Intronic
1188185953 X:27114941-27114963 AAGAGAGGGAAGGGAGGGAAGGG + Intergenic
1188767846 X:34118365-34118387 CAGAGATTTAAGGGTTCTAAGGG + Intergenic
1189466918 X:41284415-41284437 CAGTGCTGGAAGGTTTGCAAAGG + Intergenic
1189544283 X:42025545-42025567 CATAGATGGATGGGTTTGATTGG - Intergenic
1189628739 X:42928549-42928571 CAAAGATCGAAGGGTTTGTATGG - Intergenic
1189898586 X:45682446-45682468 CAAAGTTGGAAGGGTTTGAGTGG - Intergenic
1192796917 X:74431467-74431489 CAGATGGGGAAGGGTGGGAAGGG + Intronic
1193601183 X:83509641-83509663 AAGAGATGGAAGGGAAGGGAAGG - Exonic
1194224153 X:91234312-91234334 CAGGGAAGGAAGAGTAGGAATGG - Intergenic
1195000698 X:100640678-100640700 CAGGGATGGAAAGGGAGGAAAGG - Intergenic
1195392396 X:104376314-104376336 CAGAGGTGGAAGAGGTTGAAGGG - Intergenic
1195407416 X:104531105-104531127 CAGAGATATAAGGATTGGAAAGG - Intergenic
1195910248 X:109882331-109882353 TGGAGATGAAAGGGTTGGATGGG - Intergenic
1196670850 X:118366379-118366401 GAGAGATTGGAGGGATGGAATGG - Intronic
1197006412 X:121507332-121507354 CAGAGGTGGAAGAGGTAGAAGGG - Intergenic
1197272661 X:124442570-124442592 TAGACATGAAAGGGTTGGCAAGG + Intronic
1198455991 X:136818304-136818326 CTGAGGTGGAAGAGGTGGAAGGG + Intergenic
1200051885 X:153437177-153437199 CAGAGATCGAGGTGTTGGCAGGG - Intergenic
1200761731 Y:7045034-7045056 AAGAGATGGACGGGTTGCCAGGG - Intronic
1201352030 Y:13054499-13054521 CATGAATGAAAGGGTTGGAAGGG + Intergenic
1202381994 Y:24281230-24281252 CAGAGAAGGGGGGGTTGGAGAGG + Intergenic
1202488790 Y:25388895-25388917 CAGAGAAGGGGGGGTTGGAGAGG - Intergenic