ID: 1175078554

View in Genome Browser
Species Human (GRCh38)
Location 20:56397341-56397363
Sequence TGCTATGTCACATCACATAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175078552_1175078554 2 Left 1175078552 20:56397316-56397338 CCCAGAGGCTTCTGAGTACGAAA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1175078554 20:56397341-56397363 TGCTATGTCACATCACATAAAGG 0: 1
1: 0
2: 1
3: 11
4: 153
1175078551_1175078554 3 Left 1175078551 20:56397315-56397337 CCCCAGAGGCTTCTGAGTACGAA 0: 1
1: 0
2: 2
3: 6
4: 118
Right 1175078554 20:56397341-56397363 TGCTATGTCACATCACATAAAGG 0: 1
1: 0
2: 1
3: 11
4: 153
1175078553_1175078554 1 Left 1175078553 20:56397317-56397339 CCAGAGGCTTCTGAGTACGAAAC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1175078554 20:56397341-56397363 TGCTATGTCACATCACATAAAGG 0: 1
1: 0
2: 1
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175078554 Original CRISPR TGCTATGTCACATCACATAA AGG Exonic
903717985 1:25383368-25383390 TGCAAAGTCACAGCACTTAATGG - Intronic
906220855 1:44078332-44078354 TGCTTTGTCACCTGACACAATGG + Intergenic
907119712 1:51997738-51997760 AGCGAAGTCACATCACAAAAAGG + Intergenic
907364980 1:53950680-53950702 TGCTATGTTACATAAAATGAAGG - Intronic
912088819 1:106044273-106044295 TGCTATAGCAGATCACAAAAGGG + Intergenic
913182754 1:116337983-116338005 TGCTATGTTACATGACATAAAGG - Intergenic
919250339 1:195048152-195048174 TGATATGTAAAATCAAATAAAGG - Intergenic
920811425 1:209289418-209289440 TGCAATCTTACATCACACAAGGG - Intergenic
923419278 1:233796741-233796763 TGCCATGTCATTTTACATAAGGG - Intergenic
1066590929 10:36993423-36993445 TGCTTTGTAACATCACAAATGGG + Intergenic
1067284194 10:44895461-44895483 TGCTATGTCAGAACACACAGTGG - Intergenic
1068464469 10:57371099-57371121 TACTATGTCATTTCATATAAGGG + Intergenic
1068864134 10:61877239-61877261 TGTTATGTCAAGTCCCATAAGGG + Intergenic
1069137886 10:64786356-64786378 TGTTATGTAACATCACATGTAGG + Intergenic
1070493099 10:76995738-76995760 TTCTATGTCACCTTGCATAAGGG + Intronic
1070920958 10:80186181-80186203 TGATATGTTACATGATATAATGG - Intronic
1073930691 10:108570983-108571005 TGTTATGTCACATTCCAAAATGG + Intergenic
1073937790 10:108654968-108654990 CCCTATTTCACATCATATAAAGG - Intergenic
1077952472 11:6975318-6975340 TGCAATGTAAAATCACATCATGG + Intronic
1078062692 11:8058405-8058427 TGCTCAGTCACATCACAGATTGG + Intronic
1080277300 11:30516984-30517006 TGGTATATGACATCAAATAATGG + Intronic
1084777095 11:71384487-71384509 GGCTCTGTCACACCACAGAATGG + Intergenic
1085965725 11:81522083-81522105 TGCTATGTCATTTTAAATAAAGG + Intergenic
1086097157 11:83061944-83061966 TGCTATGACAGTTCACATTATGG + Intronic
1093484891 12:19641830-19641852 GGCCATGTTACTTCACATAAAGG + Intronic
1096736481 12:53659387-53659409 TTCTCTGTCACATCACAAAAGGG - Intronic
1097450488 12:59732448-59732470 TACTATGTCAGAAAACATAATGG + Intronic
1099515904 12:83596472-83596494 TTCTATGTATCATCCCATAAAGG - Intergenic
1101649709 12:106665740-106665762 TGCTATGCCACTTCACAAGAAGG + Intronic
1105751223 13:23423294-23423316 TGCTGTCTCACATCACTGAATGG + Intronic
1107172354 13:37357983-37358005 TGCTATGTTATAACACAAAATGG + Intergenic
1108507451 13:51125361-51125383 TGCTACTTCACATCAAATATTGG + Intergenic
1112956233 13:105061517-105061539 TGCTATGTGCCATAAGATAATGG - Intergenic
1116718450 14:48459685-48459707 TGCTATGTGACATCATATATTGG - Intergenic
1117652130 14:57918108-57918130 TGCTCTGGCACATCCCAAAATGG + Intronic
1120006823 14:79367540-79367562 TGTTCTGTAACATCACATCAGGG + Intronic
1120277979 14:82401510-82401532 TGCTATGACTTATCACATATGGG - Intergenic
1123912202 15:24978825-24978847 TGCTATGTCACATTATCTGAAGG + Intergenic
1126063611 15:44807769-44807791 TGCTATTTCTCATCTCAGAAGGG + Intergenic
1126326584 15:47484450-47484472 TCCTATGTAACATCACAAAGAGG + Intronic
1127323762 15:57873806-57873828 GGCTATTACACACCACATAAAGG + Intergenic
1127972712 15:63974111-63974133 TGCTCTGTCACATCAACTATAGG - Intronic
1130308507 15:82731862-82731884 CCCTATCTCACACCACATAAAGG + Intergenic
1131478967 15:92766042-92766064 TGTTATGTCACAGCTCAAAAGGG + Intronic
1134413379 16:14022147-14022169 TGCCATGTAACATCACTTACAGG + Intergenic
1137521305 16:49197772-49197794 TGCAATGTCACCTCAAGTAATGG - Intergenic
1137840741 16:51638716-51638738 TTCTTTCTGACATCACATAAGGG + Intergenic
1142167648 16:88601232-88601254 TGGAATGTCAGATCACAGAAAGG + Intronic
1144672707 17:17141944-17141966 TGCTTTTTCAAATCAAATAATGG - Intronic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1150414231 17:64974497-64974519 GGCTTAGTCACATCACATTAGGG + Intergenic
1150536504 17:66047932-66047954 TACTATGTCATTTGACATAAGGG - Intronic
1159752032 18:72314663-72314685 TGCAATGGCACACGACATAAAGG - Intergenic
1161015721 19:1981896-1981918 TGCTTTGTCACAACATATTACGG - Intergenic
1161249629 19:3273572-3273594 TGCAAAGTCACATCGCATAAAGG + Intronic
1161863813 19:6819342-6819364 TGCTGTTTCATATCACAGAATGG + Intronic
1167711690 19:51115614-51115636 CACTATATCACAGCACATAAAGG + Intergenic
925381301 2:3428351-3428373 TGCTTTGTTACACCACAAAATGG - Intronic
925715310 2:6779590-6779612 TCCTATGTGACCTCACATAGGGG + Intergenic
930894746 2:56432526-56432548 GGCTATTTCACTTAACATAATGG + Intergenic
933500819 2:83109000-83109022 GGCTATCTCACTTCACAGAAAGG - Intergenic
941432888 2:165433454-165433476 TGCTAGATCACATCATATACAGG - Intergenic
942161555 2:173194009-173194031 TGATATTCCACATCACATGATGG - Intronic
942480405 2:176381769-176381791 TGGCATTTCTCATCACATAAAGG + Intergenic
945321992 2:208435347-208435369 TGCTGTGTCACATGGCAGAAGGG + Intronic
947457718 2:230270807-230270829 TGCTATCTTACATGACAAAAGGG + Intronic
1169693760 20:8363588-8363610 TGCTGTATTACATAACATAATGG + Intronic
1169951709 20:11051523-11051545 AGCTATTTAACATCACTTAAAGG - Intergenic
1174979964 20:55382472-55382494 TGCTGTGTCACACTACATATGGG - Intergenic
1175078554 20:56397341-56397363 TGCTATGTCACATCACATAAAGG + Exonic
1178571380 21:33740343-33740365 TTAAATGTCACATCACATCAAGG - Intronic
1179206473 21:39285198-39285220 TGCTATTTCACTTAACATAATGG - Intronic
949381045 3:3446331-3446353 TGCTATGTCATGTCACAATATGG + Intergenic
951243388 3:20312931-20312953 TTTTAGGTCAAATCACATAAGGG + Intergenic
951945472 3:28131102-28131124 TGCTATTTCAAGTCACATAGTGG + Intergenic
953085913 3:39667145-39667167 TTCTATGACACATACCATAATGG - Intergenic
955136947 3:56228467-56228489 TGCTAAGTGAAATCACACAAAGG - Intronic
955419445 3:58721905-58721927 GGCCAGGTCACATCACAGAAGGG - Intronic
956423935 3:69113365-69113387 TCCTCTTTCTCATCACATAATGG - Intronic
957420655 3:79965335-79965357 TACTATGTAACATTACATAAAGG - Intergenic
960148460 3:114228046-114228068 AGCTATGTCACATGCCATGAAGG - Intergenic
960306388 3:116066695-116066717 TGCAATCTCACAGCAAATAAAGG + Intronic
961225962 3:125246366-125246388 TTTTATGTTGCATCACATAATGG - Intronic
961267626 3:125657788-125657810 TGCTGTTTCATATCACAGAATGG - Intergenic
963393763 3:144705056-144705078 TGTTAGGCCACATAACATAATGG - Intergenic
963931719 3:151010315-151010337 TGCCATGTGTCATCACATCATGG + Intergenic
967542641 3:190685367-190685389 TGGTTTCTCACATCACATAAAGG - Intergenic
972649666 4:41004464-41004486 AGCTATGTGACATCACAGACTGG + Intronic
973934988 4:55836126-55836148 TAGTATGTAACATCACATACAGG - Intergenic
974146134 4:57949705-57949727 TGTTATATTACATCACAAAAGGG + Intergenic
977830722 4:101589181-101589203 AAATATGTTACATCACATAATGG - Intronic
978383725 4:108158823-108158845 TGCTCTGTTAAATCACATAAGGG + Intronic
979789957 4:124767401-124767423 TGATATGGTACATCACAGAAAGG - Intergenic
980749752 4:137072763-137072785 TGCTATGACAGAAGACATAAAGG - Intergenic
982590110 4:157298088-157298110 TCCTAAAGCACATCACATAAAGG - Intronic
983730096 4:170982822-170982844 TGTTATGCCATTTCACATAAGGG + Intergenic
984013355 4:174398570-174398592 TGCTATGTTACATGACAAGAAGG - Intergenic
984203006 4:176750244-176750266 TGATATGTCACAACACAGTAAGG - Intronic
984339138 4:178431504-178431526 TGATATGTCACATCACTGAACGG + Intergenic
984432326 4:179664895-179664917 TGCTATTTCACATCACCTGCTGG + Intergenic
984549473 4:181143404-181143426 CGCAATGTAATATCACATAAAGG - Intergenic
987656201 5:20809869-20809891 TGTGATGTGACATCACATTATGG + Intergenic
989326042 5:40196303-40196325 TGCAATGACACATAACACAAGGG - Intergenic
991394649 5:66191586-66191608 TGTTATGTTACATGACAAAAAGG - Intergenic
992900962 5:81294970-81294992 TGTTAAGTCACTTAACATAATGG - Intergenic
994527812 5:100928425-100928447 TGCTATGCCATTTTACATAAGGG - Intergenic
995273536 5:110250976-110250998 TGCAATGTCACAGCAAATGAAGG + Intergenic
996777820 5:127152026-127152048 TTCTATGTCACATCATAACACGG + Intergenic
997089290 5:130838233-130838255 TCCTATGTCACTTTACAAAAGGG - Intergenic
999034827 5:148335815-148335837 TGCTAAATCACATCACCTCAGGG + Intronic
1001356853 5:171035287-171035309 TGCTATGGCTCAGCAGATAAAGG + Intronic
1005245359 6:23878096-23878118 AATTATTTCACATCACATAAAGG - Intergenic
1005977786 6:30813448-30813470 TGCACTCTCACATCACATAAGGG + Intergenic
1006522578 6:34580158-34580180 TGCTGTTTCATATCACAGAATGG + Intergenic
1007032028 6:38637172-38637194 TAATTTGTCACAGCACATAATGG + Intronic
1008733976 6:54519730-54519752 TGATATTTAACATCACATACTGG - Intergenic
1008772053 6:54991305-54991327 TGCTCTTTCATATCACAGAATGG - Intergenic
1012200557 6:96400941-96400963 AATTATGTAACATCACATAAAGG - Intergenic
1013862501 6:114652643-114652665 TGCTATGTGGGATCACATATTGG - Intergenic
1015943045 6:138470952-138470974 TGACATATCACATCATATAAAGG + Intronic
1016229102 6:141780493-141780515 TGCAATGACTCATCACAAAATGG + Intergenic
1024850799 7:53714471-53714493 TGCTATGTTACATGGCAAAAGGG - Intergenic
1025761126 7:64393772-64393794 TGCTATTTTATATCACAGAATGG - Intergenic
1027780184 7:82510125-82510147 TACTATGTCATTTTACATAAGGG - Intergenic
1030455638 7:109770717-109770739 TGCTATGTCATTTTATATAATGG - Intergenic
1031527991 7:122844719-122844741 TCCAAAGTCACATCAGATAAAGG + Intronic
1031569176 7:123336770-123336792 TCTTATTTCACATAACATAATGG - Intergenic
1032666604 7:134043264-134043286 TGCTGTCACACAGCACATAAAGG + Intronic
1042189763 8:66174040-66174062 TGCTATGCCACATGACATTGTGG - Intronic
1042584127 8:70316610-70316632 TGCTATGCCACATAACCAAACGG + Intronic
1043530532 8:81145145-81145167 TTCTATGTCATTTTACATAAAGG + Intergenic
1045704443 8:104904770-104904792 TGCTATCTCACAACAGATATGGG - Intronic
1047203717 8:122786808-122786830 GGCTATGACACAGCACATTACGG - Intronic
1048072263 8:131034207-131034229 AGCTATCTCAAATCAAATAAAGG - Intronic
1050491981 9:6197839-6197861 TCCTATTTCACGTTACATAAGGG + Intergenic
1050643756 9:7696322-7696344 TGTTATTTCACTTAACATAATGG + Intergenic
1051599601 9:18859458-18859480 TGCTACCTCACATGACAAAAGGG - Intronic
1051921347 9:22269614-22269636 GGCTCTGTCTCATCACATGATGG - Intergenic
1051966847 9:22838400-22838422 TCCTAAGTCAGATCAAATAAAGG + Intergenic
1052461553 9:28770494-28770516 TGCTATGTCATTTTACATGAGGG + Intergenic
1052481661 9:29036007-29036029 TGGGAAGTCACATCACAGAATGG + Intergenic
1053558202 9:39160307-39160329 GAATATGTTACATCACATAAGGG - Intronic
1053672623 9:40383561-40383583 TGCTATGTCACAGAAGACAAAGG - Intergenic
1053822319 9:41980543-41980565 GAATATGTTACATCACATAAGGG - Intronic
1054138913 9:61458619-61458641 GAATATGTTACATCACATAAGGG + Intergenic
1054383734 9:64523620-64523642 TGCTATGTCACAGAAGACAAAGG - Intergenic
1054512002 9:65992721-65992743 TGCTATGTCACAGAAGACAAAGG + Intergenic
1054608255 9:67206835-67206857 GAATATGTTACATCACATAAGGG + Intergenic
1055087882 9:72332762-72332784 TGCTAAGTCACAACACATGAAGG - Intergenic
1055703528 9:78972582-78972604 TGCTATTTCACAATACATAGAGG + Intergenic
1059226515 9:112678016-112678038 TGATATGGCATATCCCATAAGGG - Intergenic
1059373813 9:113865738-113865760 TGCAAAGTCACATGACAAAAAGG + Intergenic
1187783260 X:22853986-22854008 CGCTATATGACATCACAGAAAGG + Intergenic
1188649961 X:32620255-32620277 TGGTATGTAACATTACATACAGG - Intronic
1188811960 X:34661633-34661655 TGCACTGTCACATCACACAAAGG + Intergenic
1193838992 X:86385587-86385609 TACTATGTCATTTTACATAAGGG + Intronic
1195238502 X:102926801-102926823 TGCTATGTCTCAACATTTAAAGG + Intergenic
1195284431 X:103369970-103369992 TTCTCTGTAACATCACATAGTGG - Intergenic
1195724035 X:107895445-107895467 TGCTATGTCACTCATCATAATGG + Intronic
1197648210 X:129039821-129039843 TGCTAAGACACAGCACACAACGG - Intergenic
1198296075 X:135288032-135288054 TGTTATCTCATATCACTTAATGG - Intronic
1199755663 X:150862605-150862627 TGCTATAACAAATCACATACAGG - Intronic
1200048476 X:153415310-153415332 TGTGATGTTACATCACAAAATGG + Intergenic
1202248273 Y:22841889-22841911 TGCTCTGACACCTCACACAAAGG + Intergenic
1202401261 Y:24475637-24475659 TGCTCTGACACCTCACACAAAGG + Intergenic
1202469519 Y:25194449-25194471 TGCTCTGACACCTCACACAAAGG - Intergenic