ID: 1175083729

View in Genome Browser
Species Human (GRCh38)
Location 20:56442135-56442157
Sequence CTGTCAACACAGATATAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 238}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175083729_1175083735 21 Left 1175083729 20:56442135-56442157 CCTTTCTATATCTGTGTTGACAG 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1175083735 20:56442179-56442201 CAAATTAACATCCGAGAAGGTGG No data
1175083729_1175083730 -5 Left 1175083729 20:56442135-56442157 CCTTTCTATATCTGTGTTGACAG 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1175083730 20:56442153-56442175 GACAGTCTGCAGACTAAGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 177
1175083729_1175083732 18 Left 1175083729 20:56442135-56442157 CCTTTCTATATCTGTGTTGACAG 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1175083732 20:56442176-56442198 CCCCAAATTAACATCCGAGAAGG 0: 1
1: 0
2: 1
3: 7
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175083729 Original CRISPR CTGTCAACACAGATATAGAA AGG (reversed) Intronic
901037562 1:6345463-6345485 CTGTAAACACAGATAATAAATGG + Intronic
901522783 1:9798091-9798113 CTGTCAACAAAGAAAGAGAGAGG + Intronic
905839950 1:41167683-41167705 CTGACAACATAGAAATACAAAGG - Intronic
906910287 1:49940992-49941014 CTGACACCACAGAAATACAAAGG + Intronic
908662637 1:66453473-66453495 CTGTCAAAACTGATTGAGAATGG + Intergenic
909388585 1:75090549-75090571 CTGTCCACACAGATTTAAAGAGG + Intergenic
909547505 1:76863994-76864016 CTGTCAACATATCTATAAAATGG - Intergenic
910981735 1:92965060-92965082 CTGTCAGCACATATAAAAAATGG - Intergenic
911361308 1:96880682-96880704 CTGACACCACAGAAATACAAAGG + Intergenic
913431541 1:118799004-118799026 TTGTTAACACAGAAATACAAAGG - Intergenic
915521089 1:156444484-156444506 TTGAAAAGACAGATATAGAAGGG + Intergenic
916019312 1:160778443-160778465 ATGTCAACCCAGAGAGAGAAGGG + Intergenic
916822421 1:168412391-168412413 CTTTCAGCACAGACATGGAAAGG - Intergenic
917246012 1:173001498-173001520 CTGTAAACACAGAAATTCAAAGG - Intergenic
917481452 1:175415425-175415447 CTGTCAACAAGGACATGGAATGG + Intronic
923175047 1:231455455-231455477 CTGTTAACATAGAAATATAAAGG + Intergenic
923245375 1:232125887-232125909 CTGTCAAAAAAGACACAGAAGGG - Intergenic
1063863406 10:10337663-10337685 CTGAAAATAAAGATATAGAAAGG - Intergenic
1064347986 10:14549801-14549823 CTGTCCATACAGATAGTGAAAGG - Intronic
1064831502 10:19472717-19472739 CTGTTACCACAGAGATACAAAGG - Intronic
1064967437 10:21029573-21029595 CTGACAAAACAGATACAGACTGG + Intronic
1066279858 10:33906146-33906168 CTGTCATCACAGATCTAAATAGG - Intergenic
1067014077 10:42742736-42742758 CTGAAAACACTGATATAGGAGGG - Intergenic
1068082248 10:52333528-52333550 CTGTAGACACAAATATAGCAAGG - Intergenic
1069113188 10:64471773-64471795 CTGACACCACAGAAATACAAAGG + Intergenic
1069144346 10:64871419-64871441 CAGTCAACAAAAATATACAATGG + Intergenic
1069221074 10:65884426-65884448 CTGACACCACAGAAATACAAAGG - Intergenic
1069786673 10:70992713-70992735 CTCTCAACAAAGAGACAGAATGG - Intergenic
1070935795 10:80294090-80294112 CTGTGAACACAGAAATGGAGGGG - Intergenic
1072051220 10:91705474-91705496 CTGTCAACCCAGATGGAGTAGGG - Intergenic
1073724072 10:106209681-106209703 TTGAAAACACAGATATGGAAGGG - Intergenic
1073865063 10:107793030-107793052 CTGGCAAAACACTTATAGAAAGG + Intergenic
1074181038 10:111063665-111063687 CAGACAACACAGAAATACAAAGG + Intergenic
1075056329 10:119221385-119221407 CTATAAACACAGATATGGAAAGG - Intronic
1076265383 10:129105687-129105709 CTGTCCACAAATATAAAGAAGGG + Intergenic
1081060878 11:38475084-38475106 ATGTCAACATAGATGTAAAATGG - Intergenic
1081742279 11:45449032-45449054 CAGTCTACACAGAGATACAAAGG + Intergenic
1085210508 11:74772995-74773017 CTGTCAAAATAGATATATATTGG + Intronic
1085754033 11:79189114-79189136 ATGTAAACACAGATATGGTATGG + Intronic
1087203923 11:95374199-95374221 CTGACAACACAGAAATAAATGGG + Intergenic
1087660250 11:100979312-100979334 CTGTCATCAAAGATGTATAAAGG - Intronic
1087867977 11:103256970-103256992 CTGTCAACTGAGAGGTAGAAAGG + Intronic
1088079739 11:105896676-105896698 ATGTCAACAAAAATAAAGAAGGG - Intronic
1088085420 11:105972517-105972539 CTATCAGCACAGAAATATAATGG - Intronic
1088404901 11:109463811-109463833 TTGTCAACAAAGATATAAAATGG + Intergenic
1089106848 11:116016076-116016098 TTGACATCACAGAAATAGAAAGG - Intergenic
1090068428 11:123523814-123523836 CTTTCAGCACAGATATTGAAGGG - Intergenic
1092749126 12:11702077-11702099 CTGTCAACCCACAGATCGAACGG - Intronic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1092990216 12:13890166-13890188 GTTTCAACACAGATGAAGAATGG + Intronic
1095204162 12:39420350-39420372 CTCTCATCACAGATGTAGCAAGG + Intronic
1095656132 12:44671590-44671612 CTGATACCACAGAAATAGAAAGG + Intronic
1096644410 12:53022535-53022557 CTGACAAAACAGATACAGACTGG + Exonic
1097424041 12:59419651-59419673 CTCTCCACACAGAAATAAAAAGG + Intergenic
1098180073 12:67837485-67837507 CTGACACCACAGAAATATAAAGG - Intergenic
1098536913 12:71603479-71603501 CTGTCAATCCTAATATAGAAAGG + Intergenic
1099289431 12:80757730-80757752 CTGATAACACAGAAATACAAAGG + Intergenic
1100045883 12:90380200-90380222 ATGTCAAAATAGAGATAGAACGG + Intergenic
1103034081 12:117642213-117642235 CTGGGAACACAGATATAAAAGGG - Intronic
1105299782 13:19122103-19122125 CTGATAACACAGATATATGAAGG - Intergenic
1105321463 13:19326740-19326762 CTGATACCACAGAAATAGAAAGG + Intergenic
1106615764 13:31326143-31326165 TTTTCAATACAGTTATAGAAAGG + Intronic
1107166197 13:37282924-37282946 CTGACATCACAGAAATACAAAGG - Intergenic
1107337745 13:39373441-39373463 CTGCTAACACTGACATAGAATGG - Intronic
1107582581 13:41807015-41807037 CTGTTACCACAGAAATACAAAGG + Intronic
1108055336 13:46479663-46479685 CTATCAAGAAAAATATAGAATGG + Intergenic
1110871151 13:80453492-80453514 CTGATACCACAGAAATAGAAAGG + Intergenic
1111683022 13:91467295-91467317 CTGTCACCACAGAGGGAGAAAGG + Intronic
1112136900 13:96589359-96589381 CTGACACAACAGAAATAGAAAGG - Intronic
1114794119 14:25693084-25693106 TTTTCAACAAGGATATAGAAAGG + Intergenic
1115386695 14:32806165-32806187 TTGCCTACACAGAAATAGAACGG + Intronic
1116469579 14:45271427-45271449 TTGTCCACACAGAAAGAGAAAGG - Intergenic
1118209876 14:63755420-63755442 GTGTGAACATAGATATATAAAGG + Intergenic
1118493823 14:66288209-66288231 CTTTCAACACAGATGCAAAAGGG - Intergenic
1118879533 14:69814433-69814455 CTGGCAAAACAGATAGAAAAAGG + Intergenic
1125717019 15:41825151-41825173 CTGTCAACAGACATATAAAAGGG - Intronic
1125811296 15:42543661-42543683 GTGTTAACACAGAGATGGAATGG + Exonic
1135856687 16:26018152-26018174 CTGGCCACACAGAGATAAAAAGG - Intronic
1136547002 16:30960595-30960617 CTGGAAATACAGAGATAGAAAGG - Intronic
1138148163 16:54630934-54630956 ATATCAACATAGATAAAGAAAGG + Intergenic
1138857848 16:60716194-60716216 CTGTAAACACAGATTTTGAAAGG - Intergenic
1139227678 16:65248958-65248980 CTGTCATCACAGGTAGAAAAGGG + Intergenic
1141255976 16:82402603-82402625 TTGTCAACACAGATATCAGAGGG - Intergenic
1141273873 16:82566820-82566842 CTGTCTACACAGAGAAAGTATGG - Intergenic
1146982726 17:37181025-37181047 CTGCCAACTCAGATATTGGATGG - Intronic
1149747392 17:59112458-59112480 ATGTAATCACAGATTTAGAAAGG + Intronic
1155581666 18:27315173-27315195 TTGCCAACACAAATAAAGAAGGG + Intergenic
1158099617 18:53815732-53815754 CTGTAAATACAGATTTAAAATGG - Intergenic
1158833016 18:61301455-61301477 TTCTCAACACATACATAGAAAGG - Intergenic
1164126030 19:22318796-22318818 ATGTAAACACATAAATAGAATGG - Intergenic
1164451935 19:28373787-28373809 CTGTTTACACAGTTAAAGAAAGG + Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1167169414 19:47821378-47821400 CTGACAACACAGAGACAGAGAGG + Intronic
1168385569 19:55960294-55960316 CTGTTCACTCAGATATTGAATGG + Intronic
925684999 2:6461341-6461363 TTGTCAACAGAAATATACAAAGG - Intergenic
925964727 2:9053375-9053397 CTGGCAACACGGATACACAAAGG - Intergenic
926160318 2:10483360-10483382 GTGTCAATAAAGATATAGCATGG - Intergenic
926884116 2:17581553-17581575 CTGTTAAGACATATATACAAAGG - Intronic
927456564 2:23255417-23255439 ATGTCAAAACAGAGATAAAATGG + Intergenic
930533129 2:52615085-52615107 TTGGGAACACAGATATAGACAGG + Intergenic
930661334 2:54057077-54057099 CTATCAACCCAAATATTGAAAGG - Intronic
931946186 2:67310575-67310597 ATGACAACAAAAATATAGAAAGG - Intergenic
936910377 2:117585005-117585027 CTGACAACACAGAAATACAAAGG + Intergenic
938313299 2:130308956-130308978 CTGTCAGAAAAGATACAGAAAGG + Intergenic
939210523 2:139169424-139169446 ATGTCAAAAAAGATATACAATGG + Intergenic
939229065 2:139403286-139403308 TTGTCAAGAGAAATATAGAAGGG - Intergenic
939417224 2:141915221-141915243 CAGTCAACACAAATATGCAAAGG + Intronic
940091194 2:149920076-149920098 CTGCCACCACAGAAATACAAAGG + Intergenic
940698752 2:157014940-157014962 CTATGAACACACATATTGAAGGG - Intergenic
941159607 2:162021663-162021685 CTGTGAACACAGGTCTAGAGAGG - Intronic
941530033 2:166656944-166656966 CTGACACCACAGAAATATAAAGG - Intergenic
941548841 2:166889277-166889299 CTGTCATCTCTGAGATAGAAAGG - Intronic
943552701 2:189359883-189359905 CTGATAACACAGAAATACAAGGG - Intergenic
944178320 2:196858877-196858899 CTGATACCACAGAAATAGAAAGG + Intronic
944204078 2:197138909-197138931 ATGTCAAGACACATATGGAAAGG + Intronic
945174330 2:207026947-207026969 CTGATAACACAGAAATACAAAGG + Intergenic
945655892 2:212623534-212623556 CTGACACCACAGAAATACAAAGG + Intergenic
947898417 2:233697392-233697414 CTGACACCACAGAAATACAAAGG - Intronic
948539531 2:238678949-238678971 CTGTAAAGACACATATAGACTGG - Intergenic
1170274085 20:14564069-14564091 AAGTCAACACAGATATACACTGG + Intronic
1170979467 20:21197679-21197701 CTCTCAACAAAGACATAAAATGG - Intronic
1171364121 20:24611984-24612006 CTGTCAGCACAGCTATGCAATGG - Intronic
1171453727 20:25254499-25254521 AAGTGAACACAGATTTAGAAAGG + Intronic
1172381764 20:34499509-34499531 CTGACACCACAGAAATACAAAGG - Intronic
1174473363 20:50777939-50777961 CTGTCAAGAAAGAAAGAGAAAGG - Intergenic
1175014223 20:55771303-55771325 GGGTCAACCCTGATATAGAAGGG + Intergenic
1175083729 20:56442135-56442157 CTGTCAACACAGATATAGAAAGG - Intronic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1177582328 21:23041341-23041363 CTGTCCACATAGATAGCGAAAGG - Intergenic
1179601810 21:42483701-42483723 CTTTCTAAACAGAAATAGAAAGG - Intronic
1181841418 22:25665590-25665612 CTGGCTAAACAGATATAGAATGG + Intronic
1183163500 22:36130620-36130642 CTGGCGACCCAGGTATAGAAGGG - Intergenic
951196869 3:19834112-19834134 CTGACACCACAGAAATACAAAGG - Intergenic
951404760 3:22282062-22282084 CTGATAACACAGAAATACAAGGG - Intronic
952272605 3:31847572-31847594 GAGTCAACACAGATATGGATTGG - Intronic
955010480 3:55009798-55009820 CTGTGAAAACAGAAATAGAATGG - Intronic
955118834 3:56035145-56035167 CTGACACCACAGAAATACAAAGG + Intronic
955928087 3:64027648-64027670 CTTGCAACACAGATAAAAAAAGG - Intergenic
955941975 3:64154754-64154776 GTGAAAACACAGCTATAGAATGG + Intronic
957184444 3:76923721-76923743 CTGTCAGCACAGTTGTAGACAGG - Intronic
958013138 3:87906265-87906287 GTATCAATACAGATAAAGAAGGG - Intergenic
958181194 3:90063254-90063276 CTGTCCATACACATATGGAAAGG - Intergenic
958576838 3:95960960-95960982 CTAACAACCCAGATAGAGAAAGG + Intergenic
959235457 3:103716327-103716349 CTGTTACCACTGAAATAGAAAGG - Intergenic
959859360 3:111199349-111199371 CTGTAAACACAGCTACAGAATGG - Intronic
960344637 3:116517739-116517761 CTGTTAACATAGGTATGGAATGG + Intronic
961989891 3:131177464-131177486 CTACCAAAACAGATATAGAATGG + Intronic
963176358 3:142301867-142301889 CTGACATCACAGAAATACAAAGG + Intergenic
964997893 3:162909717-162909739 TTGTCAAAAAAGATATACAAAGG + Intergenic
965392780 3:168125614-168125636 CAGCCAACACACATATAAAAAGG - Intergenic
966513545 3:180791526-180791548 ATGTCAACAAAGACAAAGAAAGG + Intronic
967606046 3:191448477-191448499 CTGTCACCACAGAAATACAAAGG - Intergenic
968248589 3:197182090-197182112 CTGTGCATACATATATAGAAGGG + Intronic
968715884 4:2159068-2159090 CTGTCAACACAAATCCATAATGG - Intronic
972068402 4:34982092-34982114 CAGTCACCACAGCTATACAAAGG - Intergenic
972307549 4:37846358-37846380 TTCTCAACACTGATATAGAATGG - Intronic
973043761 4:45509021-45509043 CTGATACCACAGATATAAAAAGG - Intergenic
973724363 4:53759277-53759299 CTGACACCACAGAAATACAAAGG + Intronic
974024834 4:56724391-56724413 CTGTCACTACACATATAGCATGG - Intergenic
974065214 4:57071410-57071432 TTGTCAGCACAGATAAAGAAAGG - Intronic
974795981 4:66750409-66750431 CTGTCCACACTGATTTAGATGGG - Intergenic
977010928 4:91632078-91632100 CTGACACCACAGCTATATAAAGG + Intergenic
977272652 4:94937089-94937111 CTGTAAGTACAGGTATAGAAAGG - Intronic
977562451 4:98546347-98546369 CCCTCAACACAGTGATAGAAAGG + Intronic
977663192 4:99614877-99614899 CTGTCAATACAAATGTAGAAAGG + Intronic
979753420 4:124308128-124308150 CTGTCAAAATAGCTATAGGAAGG - Intergenic
980523873 4:133964146-133964168 CTGACACCACAGAAATATAAAGG + Intergenic
983176883 4:164599393-164599415 CTGATACCACAGATATACAAGGG - Intergenic
985214008 4:187629508-187629530 CTGACACCACAGAAATACAAAGG + Intergenic
986883658 5:12207135-12207157 CTGTCAACACTAATCTTGAATGG - Intergenic
986890852 5:12303227-12303249 CTGATAACACAGAAATACAAAGG + Intergenic
988334141 5:29883443-29883465 CTGACACCACAGAAATACAATGG + Intergenic
990186024 5:53210486-53210508 CTGTCAAGAAAGATATAAAGAGG - Intergenic
990223105 5:53617938-53617960 CTTTCAAAACAAATATAAAAAGG - Intronic
991232080 5:64345679-64345701 CTGTCATGACAGATGTAAAAAGG + Intronic
993342041 5:86736701-86736723 CTATAAACACACATATAGGATGG - Intergenic
994705567 5:103201338-103201360 AATTCAACACAAATATAGAAAGG - Intronic
994796981 5:104316336-104316358 CTGTCTTCACAGAGATAGTATGG + Intergenic
995045900 5:107646615-107646637 CTGTAAACACTGAGACAGAAAGG + Intronic
995842388 5:116455079-116455101 ATGTCATCACAGGGATAGAAGGG + Intronic
996053670 5:118961193-118961215 CTGTCATCACAGTTTTAGTAGGG - Intronic
996215898 5:120865124-120865146 CTGTGAATACAGAAAGAGAATGG - Intergenic
996451316 5:123628909-123628931 CTGATAACACAGAAATATAAAGG + Intergenic
997154738 5:131542404-131542426 CTATCAAGACAGACATACAAAGG + Intronic
1000773831 5:165391766-165391788 CTGATACCACAGAAATAGAAAGG + Intergenic
1001215481 5:169852064-169852086 CTGTCAGCACAGAGAGAGAGAGG + Intronic
1002942144 6:1726685-1726707 CTTGCAAAACAGATCTAGAAAGG - Intronic
1003687224 6:8315796-8315818 CTAACAACACAGAAATAAAAAGG - Intergenic
1004281241 6:14281335-14281357 CTGGCACCCCAGATATAAAAAGG - Intergenic
1005530042 6:26694558-26694580 CTGTTACCACAGAAATACAAAGG + Intergenic
1005540754 6:26807089-26807111 CTGTTACCACAGAAATACAAAGG - Intergenic
1006978977 6:38131124-38131146 CTGACAACACAGAAATACAGAGG - Intronic
1009011567 6:57849182-57849204 CTGTTACCACAGAAATACAAAGG - Intergenic
1011317312 6:86050215-86050237 CTGTCAACAAAAATATACAATGG - Intergenic
1012995879 6:105973583-105973605 CTGACATCACAGAAATAAAAGGG - Intergenic
1014304576 6:119724610-119724632 CTGTCATCACTGAAATACAAAGG - Intergenic
1014737288 6:125108754-125108776 CTGATATCACAGAAATAGAAAGG - Intergenic
1016103385 6:140130734-140130756 CTGTAAAGACACATATAGACTGG + Intergenic
1017320316 6:153084442-153084464 CTGTTAACAGAGACATAGGATGG + Intronic
1017536566 6:155353100-155353122 CTGTCTTCACAGATTTTGAAGGG + Intergenic
1018099869 6:160427889-160427911 CAGTCATCACGGAAATAGAAAGG - Intronic
1020650786 7:10873554-10873576 CTGTCAAAACAGTTTTAGTATGG - Intergenic
1021333523 7:19369186-19369208 CTGTGAAAACAGACATAGAATGG - Intergenic
1022189545 7:28004013-28004035 CTGCCAACACACATACAAAAAGG + Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024062605 7:45710148-45710170 CTGTAATCACAGATATTGAAAGG + Intronic
1024303232 7:47903977-47903999 CTGGCAAGACGTATATAGAAGGG - Intronic
1025150760 7:56545907-56545929 CTGCTACCACAGACATAGAAAGG + Intergenic
1028035723 7:85979234-85979256 CTGTCAAAAAAGAAATAAAAAGG + Intergenic
1028198058 7:87930081-87930103 CTGATAACACAGAAATACAAAGG + Intergenic
1028948958 7:96612312-96612334 CTGCCAACCAAGACATAGAATGG + Intronic
1029958811 7:104668323-104668345 CTGACAAAACAGATACAGACTGG + Intronic
1031074293 7:117198297-117198319 CTGCAAGCACAGAAATAGAACGG - Intronic
1031105555 7:117537898-117537920 CTGCAAACACATATATAGCAAGG + Intronic
1032616267 7:133474720-133474742 CTGCAAAAAGAGATATAGAAAGG - Intronic
1033029889 7:137815899-137815921 CTGACATCACAAATATATAAGGG - Intronic
1033380801 7:140816263-140816285 CTGTCTACACAGAAACTGAATGG + Intronic
1033990891 7:147285320-147285342 CAGTAAACACAGGTATAAAAAGG + Intronic
1035840461 8:2806723-2806745 CTGACACCACAGAAATACAAGGG + Intergenic
1037299869 8:17440305-17440327 CTGTCACCACAGATACACAGTGG - Intergenic
1037575074 8:20194810-20194832 CTGTAACCTCAGATATGGAATGG - Intergenic
1039201374 8:35097017-35097039 ATGTCAACAGAGAAATAGAATGG + Intergenic
1042981028 8:74528475-74528497 CTGATAACATAGATATACAAAGG + Intergenic
1044200912 8:89435006-89435028 CTGTAAACAAAGATGTCGAAAGG + Intergenic
1045790824 8:105981956-105981978 CTGACACCACAGAAATACAAAGG + Intergenic
1045980119 8:108175226-108175248 ATGTAAACAAAGATTTAGAAAGG - Intergenic
1046733353 8:117749935-117749957 CTGTCTAACCAGATATATAAAGG + Intergenic
1046883944 8:119341730-119341752 CTGACAACACAAATATGGCAAGG + Intergenic
1048219670 8:132529734-132529756 CTGTCATCACAGAGATAATAGGG - Intergenic
1049176980 8:141199271-141199293 CTGACCACACAGACATGGAATGG + Intergenic
1050646187 9:7721995-7722017 CTGTCTACAAAGACCTAGAAAGG - Intergenic
1052391967 9:27889767-27889789 CTATCAAGACAGACAGAGAAGGG + Intergenic
1052455686 9:28694406-28694428 TTGTTAATACAGATGTAGAAAGG - Intergenic
1053485287 9:38448999-38449021 CTGACATCACAGAAATACAAAGG - Intergenic
1053806547 9:41807901-41807923 ATGTCAAAACAGATATATGAGGG - Intergenic
1055170460 9:73252403-73252425 ATTTCAACAAAGATATAGAAGGG + Intergenic
1055653165 9:78427512-78427534 CTGACATCACAGAAATACAAAGG - Intergenic
1058540427 9:106006446-106006468 CTGACACCACAGAAATATAAAGG - Intergenic
1058787574 9:108405363-108405385 CTGTCAATGCAGAGACAGAATGG + Intergenic
1061749223 9:132764490-132764512 CTGGTACCACAGATATACAAAGG + Intronic
1186275452 X:7933454-7933476 ATCTCAGCACAGATATGGAAAGG - Intergenic
1187221779 X:17334240-17334262 ATGTCAACACAAATTTTGAAGGG + Intergenic
1188576950 X:31663156-31663178 CTGCCAAGACAGAGAGAGAAGGG - Intronic
1188579478 X:31692590-31692612 CTGATAACACAGAAATACAAAGG + Intronic
1189377518 X:40477084-40477106 CTGTAAACACAGATACACTAGGG - Intergenic
1189587869 X:42479314-42479336 GGGCCAACACAGAAATAGAAAGG + Intergenic
1189870342 X:45375306-45375328 CTGATACCACAGAAATAGAAAGG + Intergenic
1191611518 X:63119815-63119837 ATGTCACCACAAATATATAATGG + Intergenic
1191904654 X:66075760-66075782 CTGACAAAACAGATACAGACTGG - Intergenic
1192010487 X:67266147-67266169 CTCTCCAATCAGATATAGAATGG - Intergenic
1192395627 X:70778134-70778156 CTGTCACCAGAGACAAAGAAGGG + Intronic
1193345752 X:80402215-80402237 CTGACACCACAGAAATACAATGG - Intronic
1194088817 X:89561190-89561212 CTGGCAAAACAGATTTTGAAAGG - Intergenic
1195302649 X:103546039-103546061 CTGACATCACAGAAATACAAAGG + Intergenic
1196087569 X:111701517-111701539 CTGTTATCACAGAAATACAAAGG - Intronic
1196620494 X:117817656-117817678 CTGACACCACAGAAATACAAAGG + Intergenic
1200441490 Y:3217241-3217263 CTGGCAAAACAGATTTTGAAAGG - Intergenic
1200449219 Y:3303674-3303696 CTGACACCACAGAAATTGAAAGG + Intergenic
1201592061 Y:15626397-15626419 GTGTCTAGACAGATAGAGAATGG - Intergenic