ID: 1175084183

View in Genome Browser
Species Human (GRCh38)
Location 20:56445126-56445148
Sequence TTATATGTATATAAATTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 807
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 742}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175084178_1175084183 25 Left 1175084178 20:56445078-56445100 CCAGCCTGGGCAACAGGAGCGAA 0: 228
1: 10009
2: 33021
3: 29745
4: 27054
Right 1175084183 20:56445126-56445148 TTATATGTATATAAATTGGATGG 0: 1
1: 0
2: 4
3: 60
4: 742
1175084179_1175084183 21 Left 1175084179 20:56445082-56445104 CCTGGGCAACAGGAGCGAAGATC 0: 1
1: 5
2: 495
3: 11148
4: 34157
Right 1175084183 20:56445126-56445148 TTATATGTATATAAATTGGATGG 0: 1
1: 0
2: 4
3: 60
4: 742
1175084181_1175084183 -1 Left 1175084181 20:56445104-56445126 CCATCTCAAAAAAAAAAAAGGTT 0: 30
1: 793
2: 5764
3: 22723
4: 130076
Right 1175084183 20:56445126-56445148 TTATATGTATATAAATTGGATGG 0: 1
1: 0
2: 4
3: 60
4: 742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175084183 Original CRISPR TTATATGTATATAAATTGGA TGG Intronic
900709028 1:4099792-4099814 ATATATATATATAAATTTCAGGG - Intergenic
901888078 1:12238188-12238210 TTATATATATATATTTTGGGGGG - Intronic
902975811 1:20087673-20087695 ATATATATATATGACTTGGAAGG - Intronic
903156963 1:21452215-21452237 TTATATGTATATAAAGGGAGGGG - Intronic
903365593 1:22803749-22803771 ATATATATATATAAATTAGCTGG + Intronic
903937382 1:26905841-26905863 TTCTTTGTCTATAAAATGGATGG + Intronic
904233858 1:29100618-29100640 TTATATATATATAAAAGAGATGG - Intronic
904241640 1:29150266-29150288 TTATATATATATATTTTAGATGG + Intronic
904258018 1:29269203-29269225 ATATATGTATATAAATTAGCTGG - Intronic
904303699 1:29573267-29573289 TCCTATGTATATAATTTGGATGG + Intergenic
905082951 1:35341110-35341132 TTATTTGTATATTTATTTGAAGG + Intronic
905594776 1:39197201-39197223 TTATATATATGTATGTTGGAAGG - Intronic
905611410 1:39355325-39355347 TTATAGGTAGATGAGTTGGAAGG + Intronic
905735332 1:40321155-40321177 ATATATATATATAAATTTTAGGG + Intergenic
908017234 1:59855933-59855955 ATATATATATATAAATTAGCTGG - Intronic
908412737 1:63883502-63883524 TTATAGGTATTTTTATTGGAAGG - Intronic
908711971 1:67025680-67025702 TTTTATGTTTATTAATTAGATGG - Intronic
909266673 1:73568456-73568478 TTATATGTATATCTTTTTGAAGG - Intergenic
910019697 1:82571625-82571647 CTTTATTTATATAAATTTGAAGG + Intergenic
910410421 1:86937713-86937735 TTATATATATATAAGGTAGAAGG - Intronic
910834538 1:91495093-91495115 TTATATTTGTATAAATTTAAGGG + Intergenic
910836227 1:91515214-91515236 TTATATGCAAATAAGTGGGACGG + Intronic
911361159 1:96878049-96878071 TTACATATATGTAAGTTGGAGGG - Intergenic
911417265 1:97590328-97590350 TAATATTTATCTAACTTGGAAGG + Intronic
911607854 1:99928742-99928764 TTATATATATATAGCTTGGGAGG + Intergenic
911803833 1:102179594-102179616 TAACATGTATACAGATTGGAAGG - Intergenic
912035284 1:105304793-105304815 TTATAGGAGTTTAAATTGGATGG + Intergenic
912115523 1:106402220-106402242 TTATATATATATATATATGATGG + Intergenic
912220338 1:107666729-107666751 TTATATATATACAAATTAGCTGG - Intronic
912759328 1:112352945-112352967 TTATATGTAAGAAAATTGTAAGG - Intergenic
912864152 1:113242123-113242145 ATATATATATATATATTTGAGGG + Intergenic
913000324 1:114573756-114573778 TTATATATCTATATATTGCAAGG - Intronic
913150850 1:116041454-116041476 TTATATGTATATATTTTGTCTGG - Intronic
913397412 1:118387209-118387231 GTATATATATATATATTGGTGGG - Intergenic
913421149 1:118670820-118670842 ATATATATATATAAATTTGATGG + Intergenic
913660907 1:121005735-121005757 ATATATATATATAAATTAGCTGG + Intergenic
914165561 1:145172279-145172301 ATATATATATATAAATTAGCTGG - Intergenic
914641903 1:149614897-149614919 TCATGTGTAAATAAACTGGATGG - Intergenic
914650901 1:149697507-149697529 ATATATATATATAAATTAGCTGG + Intergenic
915153730 1:153857146-153857168 ATATATATATATAAATTGGCCGG + Intronic
916814782 1:168341122-168341144 AAATATATATATAAATTGGGAGG + Intergenic
918469222 1:184853241-184853263 TTATTTGAATATAAACTGTAAGG + Intronic
918721341 1:187856041-187856063 ATATATGTATATATATATGAAGG - Intergenic
918869818 1:189955282-189955304 TTATTTGCATTTAAATTGTAGGG + Intergenic
918890868 1:190265550-190265572 ATATATATATATAAATTAGCCGG + Intronic
919034706 1:192292107-192292129 TTATAAGTATATAAATATGTAGG + Intergenic
919072951 1:192778712-192778734 ATATATATATATATATTTGATGG - Intergenic
919357776 1:196547667-196547689 TTATATGTAGATATAATGGATGG - Intronic
920226166 1:204440756-204440778 ATATATATATATAAATTAGCTGG - Intronic
920933138 1:210407525-210407547 TTTTGTGTATGTAAATTGGGTGG - Intronic
920947396 1:210542499-210542521 ATATATATATATATATTGGTTGG + Intronic
920978274 1:210806843-210806865 ATATATATATATAAATTTGCCGG + Intronic
921409495 1:214819959-214819981 TTATATATATATATATATGATGG - Intergenic
921498045 1:215864946-215864968 ATATATATATATACATTGGAAGG + Intronic
922084723 1:222335354-222335376 TTATTTGGAAATAAAATGGAAGG + Intergenic
923147164 1:231206277-231206299 ATATATATATATAAATTAGCTGG + Intronic
923722421 1:236478484-236478506 ATATATGTATATATATATGATGG + Intronic
924013652 1:239695308-239695330 TTTTCTGTATAAAAATTGTATGG - Intronic
924228195 1:241940451-241940473 ATATATGTATATAAAATTGGTGG - Intergenic
924392232 1:243574985-243575007 ATATATTTATAGAAATTGGCTGG - Intronic
924395377 1:243613108-243613130 GTATATGTATATATATGGGTGGG - Intronic
924444578 1:244117238-244117260 TAATATGTATATAGATTAAAAGG - Intergenic
924557495 1:245130387-245130409 ATATATATATATAAATTAGCTGG + Intergenic
924872016 1:248057610-248057632 CTATATATTTATCAATTGGAAGG - Intronic
1063053876 10:2482084-2482106 ATATATGTATATAAATATGTAGG - Intergenic
1063423724 10:5934973-5934995 TTTTATTTATATAAATTTAAGGG - Intronic
1063687497 10:8251949-8251971 ATATATATATATAAATTAAATGG + Intergenic
1063800777 10:9574900-9574922 TTTCATGTCTATAAATTTGAAGG + Intergenic
1064174976 10:13066913-13066935 TTATATGTAGACACATTGAAGGG - Intronic
1064221309 10:13442544-13442566 TTAGTTTTATATAAAGTGGAGGG + Intronic
1064269967 10:13855956-13855978 TTATATTTATATATATGGAAAGG - Intronic
1064326668 10:14357630-14357652 ATATATATATATAAATTAGCTGG + Intronic
1064394763 10:14973025-14973047 TTAAATATATAAAAATTAGATGG - Intronic
1065851033 10:29789296-29789318 ATATATATATTTATATTGGATGG + Intergenic
1066279405 10:33900576-33900598 TTATATGTTTATGAATTAAAAGG + Intergenic
1066976734 10:42375803-42375825 ATATATATATATAAATTAGCTGG + Intergenic
1067423420 10:46179952-46179974 TTATATGTATAAAAATCAGTAGG + Intergenic
1067602265 10:47617035-47617057 TTATATGTATATATATGACATGG - Intergenic
1068292632 10:55023862-55023884 ATACATGTATATATATAGGAAGG - Intronic
1068292640 10:55024075-55024097 ATATATATATATATATAGGAAGG + Intronic
1068292644 10:55024123-55024145 ATATATATATATATATAGGAAGG + Intronic
1068800022 10:61130193-61130215 TTCTTTGTGTATAAAATGGAAGG - Intergenic
1069330982 10:67292564-67292586 TTATAGATATAAAAATGGGAGGG - Intronic
1069478366 10:68757724-68757746 TTATATACATATAAATTAAAAGG + Intronic
1069649382 10:70033692-70033714 TTGTAAGTATATATATTGCAGGG + Intergenic
1070003699 10:72401706-72401728 TTTTATGTATGTATATTGTAAGG + Intronic
1070110403 10:73481464-73481486 ATATATATATATATATTTGATGG - Intronic
1070185005 10:74053339-74053361 TTTTATGCTAATAAATTGGAAGG - Intronic
1070482607 10:76898538-76898560 TTATATGTATTGAGATTTGATGG - Intronic
1070561701 10:77572592-77572614 ATATATATATATAAATTAGCTGG + Intronic
1070877971 10:79832578-79832600 TTATATGTATAAAAATCAGTAGG - Intergenic
1071037941 10:81269865-81269887 ATATATGTACATAAATCTGATGG - Intergenic
1071209794 10:83326954-83326976 TTTTATGTCAATAAATTAGATGG - Intergenic
1071323056 10:84483944-84483966 ATATATATATATAAATTAGCCGG - Intronic
1071390773 10:85173128-85173150 TTATATGAATATAAACTGCTAGG + Intergenic
1071644472 10:87348620-87348642 TTATATGTATAAAAATCAGTAGG - Intergenic
1072864079 10:99040227-99040249 TTGTATGTATTTCAATTGAATGG + Intronic
1073744860 10:106456453-106456475 TAATAATTATATAAATTGGATGG + Intergenic
1073778259 10:106809665-106809687 TTATATATATATATAGTGAAGGG - Intronic
1073948330 10:108778010-108778032 ATATATATATATAAATTAGCTGG - Intergenic
1073994369 10:109298829-109298851 ATATTTGTATATAAAATTGAAGG - Intergenic
1074095666 10:110309900-110309922 TTTTATTTATATGAATTGGCTGG - Intergenic
1074245528 10:111687623-111687645 ATATATGTATATAAATATGATGG - Intergenic
1074654699 10:115571752-115571774 ATATATGAATATGAATTAGAAGG - Intronic
1076007672 10:126960717-126960739 ATATATATATATATATTTGAGGG - Intronic
1076178441 10:128386746-128386768 TTACATGAATAGAAATTAGAAGG + Intergenic
1077975822 11:7247458-7247480 ATATATGTATATATATATGATGG - Intronic
1078996249 11:16702937-16702959 TTATATATATATACATATGAAGG - Intronic
1079512926 11:21232166-21232188 ATATATATATATAAATTAGCTGG + Intronic
1079579921 11:22051308-22051330 TTATTTTTATATAAAGTGTAAGG + Intergenic
1079899147 11:26159642-26159664 TTATCTGAATATGAATTGGGGGG + Intergenic
1080139907 11:28904354-28904376 TTAAATGAATATAAATGGAATGG + Intergenic
1080194477 11:29592735-29592757 ATATGTGTATATAATTTGAAGGG + Intergenic
1080397637 11:31904664-31904686 TTATATGTATCTGAATTAGTTGG - Intronic
1080829311 11:35876642-35876664 TTATATATATATATATTTAAAGG + Intergenic
1081836764 11:46161851-46161873 TTATATATATATATATAGGCTGG - Intergenic
1082284042 11:50301019-50301041 ATATATATATATAAATTAGCCGG - Intergenic
1082712925 11:56576556-56576578 TTCTATGAATATAAATTGTTTGG - Intergenic
1082864678 11:57887807-57887829 ATATATATATATAAATTAGCTGG - Intergenic
1082899563 11:58231481-58231503 TTGCATGTATGTAAATTGGTTGG + Intergenic
1084479000 11:69406891-69406913 TGAAATGTGTATAAATTGCAAGG - Intergenic
1084874572 11:72121440-72121462 ATATATATATATAAAATGTATGG + Intronic
1084885035 11:72198436-72198458 TTATATGTGTATATATTAGCTGG - Intergenic
1085263425 11:75222178-75222200 ATATATGTATATATATTAGCCGG - Intergenic
1086179167 11:83929735-83929757 ATATATGTACATACATAGGATGG + Intronic
1086546298 11:87971438-87971460 TAATATGTCTGCAAATTGGAGGG + Intergenic
1086812749 11:91331359-91331381 ATATATGTATCTCAATGGGATGG - Intergenic
1086914060 11:92507455-92507477 TTATATGTATATATATGTGTGGG + Intronic
1087258986 11:95989634-95989656 TTATAAGGATAAAAATGGGAGGG + Intronic
1087358060 11:97121043-97121065 TTAGAAGTATAGAAATTGGCCGG + Intergenic
1087580390 11:100043895-100043917 TTATTTTTATATAAATTCAAGGG + Intronic
1087633166 11:100674717-100674739 TTATATATATATAAATTAGCTGG + Intergenic
1087690130 11:101311255-101311277 ATATATATATATAAAATGGATGG - Intergenic
1087720432 11:101658870-101658892 TTTCATGTTTATGAATTGGAAGG - Intronic
1088126995 11:106438939-106438961 TTATATGTAATTAAAATTGAGGG - Intergenic
1088173314 11:107020041-107020063 ATATATATATATAATTTGAAGGG - Intergenic
1088674913 11:112182832-112182854 TTATATATATATAAGTTCTAGGG - Intronic
1088983527 11:114885870-114885892 TGATATGTATATAAGTATGAAGG - Intergenic
1089772223 11:120811665-120811687 TTATATGTATATCTATATGAAGG - Intronic
1089944882 11:122459847-122459869 TTATATGTATATTTATAGTATGG + Intergenic
1090278717 11:125438066-125438088 TGAGATGTACATAAATTGTAAGG - Intergenic
1091056659 11:132425475-132425497 TTTTATGTATAAAATGTGGAAGG + Intronic
1091199288 11:133761161-133761183 ATATATGTATATATTTTGTAAGG + Intergenic
1092122694 12:6055733-6055755 ATATATATATATAAAGTAGATGG - Intronic
1093127579 12:15348920-15348942 TTATATTTGTATAAATTTGTTGG + Intronic
1095265313 12:40149782-40149804 TTTTTTCTTTATAAATTGGATGG - Intergenic
1095453557 12:42357738-42357760 TTTTATTTGTATAAATTTGATGG + Intronic
1095635552 12:44429143-44429165 TTTTATGTAGACAAATTGTAAGG + Intergenic
1096448697 12:51719030-51719052 TTTTTGGTATATAACTTGGAAGG + Intronic
1096819846 12:54225442-54225464 CTGTGTGTATATAAGTTGGAAGG - Intergenic
1096880420 12:54663772-54663794 ATATATGTTTATAAATTGGTGGG - Intergenic
1097362180 12:58670343-58670365 TTATATGTACATACATTGTTGGG + Intronic
1097431715 12:59516751-59516773 TTATATGGAAATAAAATGTATGG + Intergenic
1098011874 12:66061838-66061860 ATATATATATATATATAGGAGGG + Intergenic
1098242965 12:68487216-68487238 GTATATGTATTTCTATTGGATGG - Intergenic
1098437257 12:70481269-70481291 TTATTTGTAGATAAATTGAAGGG + Intergenic
1098506748 12:71261349-71261371 TTATATGAATATAAAAGAGAAGG - Intronic
1098741382 12:74177933-74177955 TTTTCTGTATATATATTTGAAGG + Intergenic
1098754504 12:74342341-74342363 CTATATATTTATAAAATGGAAGG - Intergenic
1098824592 12:75279191-75279213 TCATGTGTAAATAAATTGGCTGG - Intronic
1099004782 12:77223274-77223296 TTATAAGGATAAAAATTGTAAGG + Intergenic
1099068572 12:78015902-78015924 TTCTATCTATTTAAATTGTATGG + Intronic
1099509940 12:83522289-83522311 TTTCATATATATAAATTTGAAGG - Intergenic
1099585790 12:84511153-84511175 TAATATGTATATACATATGAAGG - Intergenic
1099647831 12:85381917-85381939 AGAGATGTATATAAATGGGAAGG - Intergenic
1099701711 12:86092290-86092312 TAATATTTATATATCTTGGAAGG + Intronic
1099773161 12:87090085-87090107 ATATATGCATATAAATTACAAGG + Intergenic
1100077818 12:90808424-90808446 TTATATTTATATAAACTATATGG - Intergenic
1100182859 12:92104406-92104428 TTATTTGTGTATAAACTGTAAGG - Intronic
1100394927 12:94177247-94177269 ATATATGTATATATATATGAGGG + Intronic
1101039404 12:100739137-100739159 TTATATATATATAAATTATAAGG - Intronic
1101983521 12:109427922-109427944 ATATATATATATATATTAGATGG + Intronic
1102734503 12:115146286-115146308 GTATATGAATTTAAATTGTAGGG + Intergenic
1103131326 12:118471092-118471114 TTATATGTATATATATTTGCAGG + Intergenic
1105049046 12:133031431-133031453 TTATATATATATATTTTAGATGG + Intergenic
1105296889 13:19095582-19095604 TCATAGCTATATAGATTGGATGG + Intergenic
1106084581 13:26529479-26529501 TTGTATGTATATAACTTTTATGG + Intergenic
1106209534 13:27628781-27628803 ATACATGTATGTATATTGGAGGG + Intronic
1106521809 13:30505129-30505151 ATATATATATATAAATTAGCTGG - Intronic
1107129142 13:36876729-36876751 TTCAATGTATCTAAAATGGATGG + Intronic
1107137638 13:36961629-36961651 ATATATGTATCTGAATTTGAAGG + Intronic
1107148852 13:37089295-37089317 TTTTAGTTTTATAAATTGGAGGG + Intergenic
1107593571 13:41936816-41936838 ATATATGTATATATTATGGAAGG - Intronic
1107828789 13:44355688-44355710 TTATGGGTCTATACATTGGAAGG - Intergenic
1107972013 13:45652688-45652710 TTAAATTTATATTAATTGGGGGG - Intergenic
1108327273 13:49346215-49346237 TATTATGTACATAAATTTGAGGG - Intronic
1108399049 13:50020879-50020901 TTATATGTAAATAAATAGTTGGG + Exonic
1108432304 13:50366548-50366570 TTTTACGTATATAAATGGCAGGG + Intronic
1108723176 13:53152623-53152645 TTAGATTTTTATAAATTTGAAGG - Intergenic
1108822088 13:54364272-54364294 ATATATATATATATATTAGATGG - Intergenic
1109410835 13:61966160-61966182 TTATATATATATAAATTTATTGG - Intergenic
1109589720 13:64462672-64462694 TTATATGTGTATAGGATGGAGGG - Intergenic
1109725608 13:66337256-66337278 AAATATATATATAAATTGAATGG - Intronic
1109949681 13:69484042-69484064 TAAGAGGTATAAAAATTGGAAGG - Intergenic
1110367468 13:74702954-74702976 TTATATTTATATAAATTGGTAGG - Intergenic
1110550267 13:76804313-76804335 ATATATGTATATATATTGACAGG - Intergenic
1111250574 13:85595837-85595859 GTATATATATATTAACTGGAGGG - Intergenic
1111315462 13:86552419-86552441 TTATATCTATGTACATTAGAAGG - Intergenic
1111354003 13:87073729-87073751 GTATGTGTAGATTAATTGGAAGG - Intergenic
1111354852 13:87085151-87085173 GTAAATGTTTATAAATTGTATGG - Intergenic
1112863283 13:103862070-103862092 ATATATATATATATATTAGATGG + Intergenic
1112884615 13:104153748-104153770 ATATATGTTAATAAATTGGTAGG - Intergenic
1113132663 13:107055646-107055668 TTTTATGAATATAAATCTGAGGG - Intergenic
1115315647 14:32022243-32022265 ATATATATATATATATTAGATGG + Intergenic
1115660452 14:35489320-35489342 ATATATGTATTTATATTGGGGGG - Intergenic
1115689679 14:35829744-35829766 TTATTTTTATATAACATGGAAGG - Intronic
1116104848 14:40489041-40489063 TTATCAGTATATAAATAGCATGG + Intergenic
1116864281 14:50018731-50018753 TTATTTTTGTTTAAATTGGATGG - Intergenic
1117267718 14:54107479-54107501 TTATTTTCACATAAATTGGATGG - Intergenic
1117579830 14:57141278-57141300 TTATATATATATATATATGATGG - Intergenic
1118122727 14:62863881-62863903 TTATATGTATCTGAATGTGAGGG + Intronic
1118429721 14:65704689-65704711 TTATATGTTTATAAGTTAAATGG + Intronic
1118666733 14:68077988-68078010 TTATATGTACATAAGGTGGAAGG + Intronic
1118883359 14:69847288-69847310 CAATATGTATATAAATTGTTTGG + Intergenic
1118942599 14:70351886-70351908 GTATATTTATATAAAAAGGAAGG + Intronic
1119225465 14:72941604-72941626 TTATATGCATAAAAATCTGACGG - Intronic
1119940420 14:78634846-78634868 GTATATATATATAAATTAGTGGG + Intronic
1120102357 14:80460051-80460073 ACATATGTCTGTAAATTGGATGG + Intergenic
1120120256 14:80670407-80670429 GTGTATGTATATAAATAGGTAGG - Intronic
1120355942 14:83434040-83434062 ATATATGTATATATATATGATGG - Intergenic
1120694179 14:87625576-87625598 GTTTATGTATATATAGTGGAAGG - Intergenic
1121125763 14:91405764-91405786 TTATTTTGTTATAAATTGGAAGG + Intronic
1121593846 14:95143404-95143426 TTAAATTTATATACATTGAAAGG - Intronic
1121910570 14:97788445-97788467 TTATATATATATATATATGAAGG + Intergenic
1122255863 14:100475879-100475901 TTATATATATATATATTTGGGGG - Intronic
1123508841 15:20974291-20974313 TTATTTGACAATAAATTGGAAGG - Intergenic
1123566065 15:21548040-21548062 TTATTTGACAATAAATTGGAAGG - Intergenic
1123602323 15:21985327-21985349 TTATTTGACAATAAATTGGAAGG - Intergenic
1124086457 15:26555020-26555042 ATATATATATATAAATTAGCTGG + Intronic
1124566702 15:30822265-30822287 TTATATGTATATAACATAAACGG + Intergenic
1124733590 15:32223097-32223119 ATATATATATATATATTTGATGG + Intergenic
1125060888 15:35422110-35422132 TTATATATATATATATTTGAAGG - Intronic
1125857712 15:42966398-42966420 TTAAATGTTTAAAAATTGCATGG - Intronic
1126667421 15:51087927-51087949 ATATATATATATATATGGGAAGG + Intronic
1126924476 15:53567730-53567752 TTTTATGTATATAATTTTCAAGG - Intronic
1127297404 15:57621078-57621100 TTATATATATATAAATTATTTGG + Intronic
1128076116 15:64826615-64826637 ATATATATATATAAATTAGCTGG - Intergenic
1129002057 15:72343230-72343252 ATATATATATATGAATTAGATGG + Exonic
1129639494 15:77360478-77360500 ATATGTGTATATATATTGGCTGG - Intronic
1130658646 15:85812228-85812250 ATATATATATATAAATTAGCTGG - Intergenic
1130916028 15:88305437-88305459 AGATATGGATATACATTGGACGG - Intergenic
1131485495 15:92816649-92816671 TGATATTTATATTAATGGGAAGG + Intergenic
1131708021 15:95019761-95019783 TTATATCTCAATAAAATGGAAGG - Intergenic
1131745894 15:95446821-95446843 ATATATATATATAAAGTTGAAGG + Intergenic
1131853838 15:96571066-96571088 ATATATATATATATATTGGCAGG - Intergenic
1132328935 15:100997162-100997184 ATATATGTTTAGAAATTGAAAGG - Intronic
1202974428 15_KI270727v1_random:275134-275156 TTATTTGACAATAAATTGGAAGG - Intergenic
1134014046 16:10876313-10876335 TTATTTGAATATAAAGTAGATGG - Intergenic
1134636681 16:15797532-15797554 TTATATATATATATATTTGAAGG - Intronic
1135080871 16:19433979-19434001 ATATATATATATAAATTAGCTGG - Intronic
1135208325 16:20500980-20501002 TTGTACGTAAATAACTTGGAGGG + Intergenic
1135210574 16:20522720-20522742 TTGTACGTAAATAACTTGGAGGG - Intergenic
1135595056 16:23735521-23735543 ATATATATATATATATTTGAGGG - Intergenic
1138260284 16:55615203-55615225 TTGTTTTTATATAAAATGGAAGG - Intergenic
1138764812 16:59589550-59589572 GTATATGTGTATAATTTGAAGGG + Intergenic
1138788130 16:59870135-59870157 ATATATATATATAAATTAGCTGG - Intergenic
1138792643 16:59925216-59925238 TAATATATATTTAAATTGGGTGG - Intergenic
1138877173 16:60966161-60966183 ATATATATATATATATTTGAGGG - Intergenic
1139074190 16:63423428-63423450 TTATATGTAGATTAAATGAATGG + Intergenic
1139737271 16:69002294-69002316 ATATATATATATAAATTAAAGGG - Intronic
1139759790 16:69175365-69175387 ATATATATATATAAATTAGCCGG - Intronic
1139833120 16:69816674-69816696 GTATATGTATATACATATGAGGG - Intronic
1140134430 16:72193077-72193099 TTATTTTTATAAAAATTAGAGGG - Intergenic
1140672861 16:77296158-77296180 ATATATTTATATAAAATGGATGG - Intronic
1141278756 16:82611369-82611391 ATATATATATATATATGGGATGG - Intergenic
1144220515 17:13095608-13095630 ATATATATATATAACTTGTAAGG - Intergenic
1144333082 17:14241960-14241982 TTTTATTTATATAAAGTGCAAGG - Intergenic
1144560715 17:16318569-16318591 TTATATATATATAAAGAGTAGGG - Intronic
1144612149 17:16729872-16729894 ATATATATATATGAATTGTATGG + Intronic
1145887423 17:28392271-28392293 ATATATATATATAAATTAGCTGG - Intronic
1146321310 17:31848876-31848898 GTATATGTATAAAGATTAGAAGG - Intergenic
1146529481 17:33596076-33596098 TGATTTGTAGACAAATTGGAGGG - Intronic
1149141856 17:53440818-53440840 GTATATATATATAAAATGAAGGG + Intergenic
1149172486 17:53827271-53827293 TAAAAGGTATAAAAATTGGAAGG - Intergenic
1149413475 17:56433460-56433482 ATATATGTATATATATATGATGG + Intronic
1150223914 17:63512478-63512500 TAAAATGTCTATAAAATGGAAGG - Intronic
1150313542 17:64149323-64149345 TTATATGTATACAAAATCAAAGG - Intronic
1150549236 17:66193814-66193836 TTATATGTATATAACATGAAAGG + Intergenic
1150629332 17:66867941-66867963 TTCTATGCATTTAAAATGGAAGG - Intronic
1150794054 17:68223875-68223897 ATATATATATATAAATTAGCTGG - Intergenic
1150940791 17:69691934-69691956 TTAAATGTAGTTAAATTGCATGG - Intergenic
1152004427 17:77670527-77670549 TTATATATATATAAACTGAATGG - Intergenic
1152591005 17:81212159-81212181 ATATATATATATAAATTAGCCGG + Intronic
1153118559 18:1691518-1691540 TTATGCATATATAAACTGGAAGG + Intergenic
1153189818 18:2525367-2525389 ATATACGCATATATATTGGAAGG - Intergenic
1153329453 18:3858594-3858616 TTACATGTATAGATACTGGAAGG + Intronic
1155018253 18:21868455-21868477 TTAAATGTCTATTCATTGGAAGG + Exonic
1155614458 18:27704923-27704945 TTAAATGTTTATAGATTGAATGG - Intergenic
1155644983 18:28066266-28066288 TTATATGTAATTAATTTTGAAGG - Intronic
1155738330 18:29252618-29252640 TAATATGTTCATAAATTGGCGGG - Intergenic
1155818448 18:30345827-30345849 TTAAATGTGAAGAAATTGGAGGG - Intergenic
1155974039 18:32108966-32108988 TTTTATGTATATAGGTTTGATGG + Intronic
1156599653 18:38590117-38590139 TTAAATGTATTTAAATTAAATGG - Intergenic
1156758831 18:40561677-40561699 TTTTATATATATAACTTTGATGG - Intergenic
1156914765 18:42452739-42452761 TTGAATGTAGATAAAGTGGATGG + Intergenic
1156950402 18:42889716-42889738 TTATATGTATAAATGTTTGATGG - Intronic
1156991095 18:43408285-43408307 TTATTTATATATAAAGTGCATGG - Intergenic
1157169849 18:45393233-45393255 ATATATGTATATAAAATGTTGGG + Intronic
1157645256 18:49262552-49262574 TTATATGTATCAATATAGGAGGG - Intronic
1158563411 18:58534247-58534269 TTAGATTTAGATAAATGGGAAGG + Intronic
1158681694 18:59573278-59573300 ATATATATATATATATTAGACGG - Intronic
1159214703 18:65376183-65376205 TTATGAGTATCTAAATTGAAAGG - Intergenic
1159297701 18:66517653-66517675 TTATATCTATCTACTTTGGATGG - Intronic
1159311267 18:66713635-66713657 ATATATATATATAATTTGAATGG - Intergenic
1159416833 18:68162022-68162044 ATATATGTAAATAAAGAGGAAGG + Intergenic
1159526971 18:69604871-69604893 TTTTATTTGTATAAATTTGAGGG + Intronic
1159610262 18:70517088-70517110 TTACATGTGAATAATTTGGATGG + Intergenic
1159930958 18:74312519-74312541 ATATATGTATATAAAATGTTTGG - Intergenic
1160282533 18:77505416-77505438 TTCTATTATTATAAATTGGAAGG - Intergenic
1161196658 19:2990304-2990326 ATATGTATATATAAATTGGCCGG + Intronic
1161838271 19:6662717-6662739 TGATATGCATACAAATTAGAGGG - Intronic
1162078991 19:8207923-8207945 ATATATATATATAAATTAGCCGG + Intronic
1163024427 19:14502005-14502027 ATATATATATATAAATTCGCTGG + Intergenic
1163463448 19:17453080-17453102 ATATATATATATAAATTAGCTGG - Intronic
1163894178 19:20042763-20042785 TAAAATGTATATACATTGAAAGG + Intergenic
1164049743 19:21574820-21574842 TCATATGTACATACATTGGAAGG + Intergenic
1165021776 19:32930424-32930446 TAAAATGGGTATAAATTGGATGG + Intronic
1165522323 19:36324424-36324446 TTATATACATATAAATCGGCTGG + Intergenic
1165717733 19:38057356-38057378 ATATATGTATATATATGGGAAGG + Intronic
1167011070 19:46808153-46808175 ATATATATATATATATTGGCTGG - Intergenic
1167476125 19:49701804-49701826 TTATATATATATAAATGTGGAGG - Intronic
1167657522 19:50775127-50775149 TTATATGTATATACTGTGCACGG + Intergenic
925043460 2:752253-752275 TTATATGTTAATAAATTGTTAGG - Intergenic
925504705 2:4548853-4548875 TTATATGTCAATAAATTGCCGGG - Intergenic
925951217 2:8913414-8913436 TTAGATGTATATAGATTGTGAGG - Intronic
926474099 2:13300834-13300856 TGATATGTATAAAAATTGCATGG - Intergenic
926537274 2:14128595-14128617 TTATATGTATATAAAACCTATGG + Intergenic
926540888 2:14179916-14179938 TGATATATGTAAAAATTGGAAGG + Intergenic
926588126 2:14711474-14711496 ATATATATATATAAATTAGCTGG + Intergenic
926644664 2:15276529-15276551 TTTTATGTATATAAATGGCAAGG - Intronic
926777903 2:16440354-16440376 ATATATATATATATATTGGCCGG + Intergenic
926902460 2:17768664-17768686 TTAAAAGTATATTAATTGAACGG - Intronic
927031908 2:19129065-19129087 TAATATATATATTAATTGGCTGG + Intergenic
927231383 2:20827288-20827310 ATATATATATATAAATTAGCCGG - Intergenic
928116465 2:28548580-28548602 TTATATATATATATATAGAAGGG - Intronic
928475349 2:31620911-31620933 TTATATATATATAATTTTTAAGG - Intergenic
928764440 2:34626768-34626790 ATATATGTATAAATATTGGGAGG + Intergenic
928769170 2:34685554-34685576 TTTTATGGAAATAAACTGGATGG + Intergenic
928929558 2:36610434-36610456 GTATATGTATATATATTAGCTGG + Intronic
929308258 2:40391136-40391158 TTATATATATATATATTTTAAGG - Intronic
929359643 2:41070916-41070938 ATATATGTATATAAATTAGCAGG - Intergenic
930557612 2:52918987-52919009 TTCTGTGTATGTCAATTGGATGG - Intergenic
930792109 2:55344209-55344231 TTATATTTATATAAAGTTGGAGG + Intronic
931061917 2:58539462-58539484 ATATATTTCTATAAATTGAATGG + Intergenic
933175755 2:79170555-79170577 TTATATGAATAAACATTGCATGG - Intergenic
933207222 2:79521156-79521178 ATATATATATATAAATTTTAAGG + Intronic
933360658 2:81279452-81279474 TTTTATGTATAGAAAGTGAAAGG + Intergenic
933396538 2:81739412-81739434 TTATATAAATATAAATTTGGTGG - Intergenic
933483747 2:82891787-82891809 TTGTTTGTATATAAATTAAATGG - Intergenic
935123984 2:100206649-100206671 TTTTATTTATATAATTTTGATGG - Intergenic
935543226 2:104373962-104373984 ATATATGTATATATATTGTTTGG - Intergenic
935894436 2:107719603-107719625 TTATATGGGTATAAAATGGGGGG - Intergenic
936931367 2:117792648-117792670 TTATATACATATAAATTATATGG - Intergenic
937171589 2:119876751-119876773 TTATATCTTTAAAAATTGGTGGG + Intronic
937532439 2:122845393-122845415 ATATATATATATAAATTAGCTGG + Intergenic
937761405 2:125607875-125607897 GTATATGTACATAAAATAGATGG + Intergenic
938596211 2:132789830-132789852 CTATTTGACTATAAATTGGAGGG - Intronic
938679520 2:133675161-133675183 TTAAATGTATTTTAATTGGCTGG + Intergenic
939508756 2:143080909-143080931 TTATATATAGATCAATTAGAAGG + Intergenic
939512080 2:143119679-143119701 ATATATATATATATATTTGATGG - Intronic
939514197 2:143145815-143145837 CTATACATATATAAATTGGAAGG - Intronic
939698335 2:145356758-145356780 TTATATAAATAAAAGTTGGAGGG - Intergenic
939909190 2:147960175-147960197 TTATGCATATATAAAATGGAAGG - Intronic
940253504 2:151705162-151705184 ATATATATATATAATTTTGAAGG - Intronic
940628302 2:156205036-156205058 ATATATGTAAATATAATGGAAGG - Intergenic
940792182 2:158040784-158040806 TTATTTGTAAATAAATTTGGTGG + Intronic
941146846 2:161858618-161858640 TTATATTCATATAAATTACAGGG + Intronic
941848150 2:170151894-170151916 TTATATGTAAGTCAATGGGAAGG + Intergenic
941979889 2:171443256-171443278 GTATATGTATATAAACCAGAAGG + Intronic
943017822 2:182535643-182535665 TTAAATGTATGTACATTTGACGG + Intergenic
943086228 2:183315027-183315049 TTATATGTTTCAAAATGGGAAGG - Intergenic
943499282 2:188666429-188666451 ATATATATATATAAATTTGAGGG - Intergenic
943784497 2:191862111-191862133 TTATTTTTATATACATTGAATGG + Intergenic
944332411 2:198486508-198486530 TTATATATCTTTAATTTGGATGG + Intronic
944777677 2:202984224-202984246 TTAAAAGTACAAAAATTGGAAGG - Exonic
945179662 2:207078953-207078975 TTGTATGTATGTTAGTTGGAGGG - Exonic
945499542 2:210554054-210554076 ATATATGTATATATATTTTATGG - Intronic
945732571 2:213557321-213557343 TTACATGTATATAAAATTGCAGG - Intronic
946317763 2:218929199-218929221 TTCTATGTATATAAATTAATAGG - Intergenic
946357847 2:219199853-219199875 TTATATTTATATACATTGGGAGG + Intronic
947429977 2:230019048-230019070 TTATATTTATATATATTCCAGGG - Intergenic
948006721 2:234615633-234615655 TAATATGTATACGAATTAGAAGG + Intergenic
948968348 2:241402827-241402849 ATATATATATATAAATTAGCTGG - Intronic
1169953728 20:11077960-11077982 TCATAGGTAGATAAAATGGATGG + Intergenic
1170911617 20:20576586-20576608 TTATATGTTTATAAGTGAGATGG + Intronic
1171138035 20:22715241-22715263 TTATTTGTATAGAAATTAGAGGG - Intergenic
1173431719 20:42993611-42993633 TCATATGTAAATAAACTGAAAGG - Intronic
1173779200 20:45740132-45740154 TTATATGTATATATTTTTCAAGG + Intergenic
1175083563 20:56440959-56440981 TTTTAAGTAAATAAATAGGAAGG - Intronic
1175084183 20:56445126-56445148 TTATATGTATATAAATTGGATGG + Intronic
1175460841 20:59150959-59150981 GTATTTGTATATAATTTGCATGG - Intergenic
1176317452 21:5260390-5260412 ATATATATATATATATTTGATGG + Intergenic
1176514379 21:7772989-7773011 TTGTTTGTATATAAATTTAAGGG - Intergenic
1177289162 21:19087867-19087889 TTATATGGATATAGATAGAAGGG - Intergenic
1177521027 21:22226078-22226100 TGACATGACTATAAATTGGAAGG + Intergenic
1177564425 21:22800060-22800082 TTATACATATATATATGGGAAGG - Intergenic
1177566311 21:22827085-22827107 TAATATGTTTATAATTTGGGGGG - Intergenic
1177709414 21:24752535-24752557 TAATTTGTACATTAATTGGAAGG - Intergenic
1177813296 21:25948060-25948082 TTAAATGTATATAGATTTAATGG - Intronic
1178612201 21:34093765-34093787 TTAAATGTATTAAAATTTGACGG - Intronic
1178648492 21:34403513-34403535 TTGTTTGTATATAAATTTAAGGG - Intronic
1179508424 21:41856635-41856657 TAAGATGTATGTAAATTGCAAGG - Intronic
1180771123 22:18386735-18386757 TTATATATATATATATTTGTGGG - Intergenic
1180771209 22:18387571-18387593 TTATATATATATATATTTGTGGG - Intergenic
1180807933 22:18733683-18733705 TTATATGTATATATATTTGTGGG + Intergenic
1180829388 22:18893213-18893235 TTATATATATATATATTTGGGGG - Intergenic
1181193929 22:21167598-21167620 TTATATATATATATATTTGTGGG + Intergenic
1181215511 22:21325180-21325202 TTATATATATATATATTTGTGGG - Intergenic
1182730591 22:32488268-32488290 TTAAACCTATATAAATTTGATGG + Intronic
1185170093 22:49288053-49288075 TTATAAGAAAATAAAGTGGATGG - Intergenic
1203232959 22_KI270731v1_random:127899-127921 TTATATATATATATATTTGTGGG - Intergenic
1203233047 22_KI270731v1_random:128773-128795 TTATATATATATATATTTGTGGG - Intergenic
1203279478 22_KI270734v1_random:118518-118540 TTATATATATATATATTTGGGGG - Intergenic
949115781 3:320876-320898 TCTTCTGTATATAATTTGGAGGG + Intronic
949302334 3:2598798-2598820 TTTCATGTATATATGTTGGAGGG - Intronic
949306711 3:2650081-2650103 ATATATATATATAAAAGGGAAGG + Intronic
949400700 3:3662637-3662659 TAATATGTCTTTAGATTGGAGGG - Intergenic
949792319 3:7806615-7806637 CTGTATGTAAATGAATTGGAAGG - Intergenic
950112015 3:10425146-10425168 GTATATATATATAAATTAGCTGG + Intronic
951018023 3:17750829-17750851 TGATAGATATATAAATTGAATGG - Intronic
951828399 3:26895261-26895283 GTTTATTTATATTAATTGGATGG - Intergenic
951950580 3:28196063-28196085 TAATATGTAAATAAATGGAAAGG - Intergenic
952565871 3:34656674-34656696 TTATATGTATATAAGGTGTAAGG - Intergenic
952766850 3:36961689-36961711 ATATATGTATAAAAATTAGCTGG - Intergenic
952775917 3:37046572-37046594 ATATATGTATATATATATGAAGG - Intronic
953388680 3:42522074-42522096 ATATATATATATATATTCGAAGG - Intronic
953631503 3:44621899-44621921 TTATATGTATATAATATATATGG - Intronic
953668707 3:44944861-44944883 TTTTATATATGTAAAATGGAGGG - Intronic
955102846 3:55869012-55869034 TTATATGTTTATAATAAGGAAGG - Intronic
955208941 3:56923064-56923086 ATATATATATATAAATTAGTTGG + Intronic
955940742 3:64145259-64145281 ATATATATATATAAATTAGCTGG - Intronic
956314839 3:67922733-67922755 TTATGTGTATGTAATTTGTATGG + Intergenic
956387859 3:68739964-68739986 TTATATTTGTATAAATTTAAGGG - Intronic
956561577 3:70582704-70582726 TTATATGTAGATAAATAGCTAGG - Intergenic
956656306 3:71555976-71555998 TTATAAGAAAATAAATGGGATGG + Intronic
956688088 3:71850693-71850715 TTATATTTCTATAAATGGAATGG - Intergenic
957017823 3:75090484-75090506 TTATTTGTATATAACATAGATGG - Intergenic
957121070 3:76093562-76093584 ATATATTTATATAAATTGCTTGG + Intronic
957142091 3:76373427-76373449 TTATATGTGCATAATTTGGATGG + Intronic
957667850 3:83258229-83258251 ATATATATATATAACTTGAAAGG + Intergenic
957676301 3:83370694-83370716 TTATATGTATATATTTTGGGGGG - Intergenic
957784043 3:84857381-84857403 ATATATGCATATAAAATGAAAGG + Intergenic
958017149 3:87951734-87951756 TTATATGCATATATATATGATGG + Intergenic
958683582 3:97363165-97363187 ATATATATATATATATTGCAGGG - Intronic
958805821 3:98809019-98809041 TCATATATATATATATGGGAAGG + Intronic
959035337 3:101356501-101356523 TTATTTGTATATAACTTTAAAGG - Intronic
959268735 3:104177134-104177156 CTATGTATATATAAATTGCAAGG + Intergenic
959284050 3:104384282-104384304 TTATATATATATAACTTGGAGGG + Intergenic
959356612 3:105338602-105338624 TTATATATATATATATTTGAAGG + Intergenic
959364732 3:105442825-105442847 GTATATGTATTTAAAGTTGAAGG - Intronic
959407061 3:105972901-105972923 ATATATGGATATAAAAAGGATGG - Intergenic
959532628 3:107451014-107451036 TCATATGTATAAAACTTTGAAGG - Intergenic
960090569 3:113634310-113634332 TTCTATAAATAGAAATTGGAAGG - Intergenic
960292921 3:115908218-115908240 TTATATATATATAAACTGAGGGG - Intronic
960312843 3:116137528-116137550 TTATATGTAAATCCATTGGAAGG - Intronic
960515916 3:118602643-118602665 TTATATATATATAAAATCCATGG - Intergenic
961146790 3:124600630-124600652 ATATATATATATAAATTTCATGG - Intronic
961232506 3:125329929-125329951 GTATATGTATAGAAATTGTCTGG + Intronic
961252910 3:125521704-125521726 TTATGTGTATATAAAATAGGGGG - Intergenic
961973632 3:130997345-130997367 TTACATGTAAATGAATTGGATGG + Intronic
962545787 3:136433299-136433321 TTATATATATATATATTTTAAGG - Intronic
962641185 3:137388323-137388345 ACATATGTATATATAATGGATGG - Intergenic
962815782 3:138997525-138997547 TAAAATTTATATAAATTGCAGGG - Intergenic
963080465 3:141388379-141388401 TATTATGTATATAATTTGGGGGG + Intronic
963135952 3:141904240-141904262 TTATCAGTATATAAATGTGAAGG - Intronic
963168691 3:142230183-142230205 TAATAGGTATAAAAAATGGAAGG - Intergenic
963305394 3:143646228-143646250 TTATTTATATATAAATTACATGG - Intronic
964190428 3:153994182-153994204 ATATATGTATATATATACGATGG + Intergenic
964224134 3:154377905-154377927 TTATATATATTTAAATTTTATGG + Intronic
964296994 3:155244647-155244669 TTATCTCTAAATAAAATGGAAGG + Intergenic
964464419 3:156974712-156974734 TTATAGGTATATTAATTAGAGGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965565498 3:170112370-170112392 ATATATATATATAAATTAGCTGG - Intronic
965841476 3:172910492-172910514 TAATATGTAAATAAATGGCATGG + Intronic
966049005 3:175590205-175590227 ATATATATATATATATTAGACGG - Intronic
967485279 3:190023120-190023142 CTATATGTATATATTTTGGCTGG - Intronic
969452888 4:7285015-7285037 ATATATATATATATATGGGATGG - Intronic
970548839 4:17158197-17158219 GTATATGTATATATATATGACGG - Intergenic
970619881 4:17807049-17807071 TTATATGTATATGTATTAAATGG - Intronic
970630663 4:17940214-17940236 ATATATGTATATAAAATCTAAGG + Intronic
970670424 4:18390503-18390525 ATATGTGTAAATAAATTGAAAGG - Intergenic
970833914 4:20377404-20377426 TTCTAAGTATATAAAATGGGAGG + Intronic
970865057 4:20748549-20748571 ATATATATATAAAATTTGGAAGG - Intronic
971246446 4:24933200-24933222 TTGTATGTACTTAAATGGGAGGG + Intronic
971661265 4:29419300-29419322 CTATATGTATATAAATGTGTGGG + Intergenic
972261642 4:37414830-37414852 ATATAAGTAAAGAAATTGGAAGG - Intronic
972842086 4:42943282-42943304 ATTTGTGTATATAAATTAGAGGG + Intronic
972910967 4:43816620-43816642 TTATATATATATAAAATGAACGG - Intergenic
972981580 4:44710333-44710355 TTATATGTAGTTAAATTATATGG - Intronic
973094025 4:46174961-46174983 TTATATGCATATAAATTAGTGGG - Intergenic
973170563 4:47137859-47137881 TTATATATACATATATTGGATGG - Intronic
973206486 4:47565768-47565790 TTTTATTTATATAAATTTAAGGG - Intronic
974197627 4:58596310-58596332 TCATATATATATATATTAGATGG + Intergenic
974204887 4:58688989-58689011 CAATGTGTATATAAATTGAAAGG - Intergenic
974655337 4:64812069-64812091 TTTTATGTATATATATTTTATGG + Intergenic
974883741 4:67790752-67790774 ATAAATGAATATAAATTTGAGGG + Intergenic
975134912 4:70865488-70865510 ATATATGTATATACACTGCAAGG + Intergenic
975634013 4:76427992-76428014 TTATATATACATAAAATTGAGGG - Intergenic
976771193 4:88654484-88654506 TTATATATATATAAATTCCTTGG + Intronic
976933213 4:90594385-90594407 TGATATGTATATAAATATGTAGG + Intronic
977075888 4:92448508-92448530 TAATTTGTATATAATTTGGTAGG - Intronic
977090776 4:92673178-92673200 TTTTATATATATATATTTGATGG + Intronic
977732189 4:100367076-100367098 ATATATATATATAAATTGGTTGG + Intergenic
977773433 4:100887775-100887797 TAACGTGAATATAAATTGGATGG - Intergenic
977807387 4:101317379-101317401 TTACAAGTATGTAAAATGGAAGG - Intronic
977966558 4:103156554-103156576 TTATTTGTATATATAGTGTAAGG - Intronic
977991925 4:103454061-103454083 AAATATGAATATAAATTTGAAGG + Intergenic
978014970 4:103732749-103732771 GTATATATATATAAATTAGCTGG + Intergenic
978480227 4:109181193-109181215 TTATATGTATATGATTGGGGTGG + Intronic
979045785 4:115861410-115861432 TTATAGATGAATAAATTGGATGG - Intergenic
979066159 4:116136445-116136467 ATATATATATATATATTGCAGGG + Intergenic
979823065 4:125197837-125197859 TTATATAAATATAAAATGGAAGG + Intergenic
979895545 4:126151522-126151544 TTTTATTTATATAAATTTGTAGG - Intergenic
980269566 4:130566483-130566505 TTATATCTTTTTTAATTGGAAGG + Intergenic
980468414 4:133217395-133217417 TTAAATAAATATAAATTGAAAGG + Intergenic
980762430 4:137253414-137253436 TGATATGAACATAAATTGGGAGG - Intergenic
981095351 4:140773700-140773722 TAATCTTTATAAAAATTGGAAGG + Intergenic
981106276 4:140885360-140885382 TAATATATATATAAATTAGCTGG - Intronic
981131048 4:141158853-141158875 TTATCTGTGAATAAATTGGAAGG - Intronic
981801343 4:148660677-148660699 TTATATATATATAAATTATATGG - Intergenic
981909059 4:149956723-149956745 TTGAATCTATATAAATTGAACGG + Intergenic
981972673 4:150684477-150684499 TTTGATGTATATAAATTGCCTGG - Intronic
982991458 4:162281803-162281825 TTTTATATATATATATTAGATGG + Intergenic
983184392 4:164684755-164684777 TTATCTGTATCTATATTGGGAGG + Intergenic
983312204 4:166079029-166079051 TTACAAGTATAGAGATTGGAAGG - Intronic
983604298 4:169568633-169568655 ATATTTGAATATAAATAGGAAGG + Intronic
983686751 4:170419338-170419360 TTCTATGTTAATAAATTGGAAGG + Intergenic
984508404 4:180649944-180649966 GTATATATATATAAAATGAAAGG - Intergenic
984593481 4:181641659-181641681 TTATATATATATATATTCCATGG - Intergenic
985703055 5:1385231-1385253 TTATTTGGTTAAAAATTGGATGG - Intergenic
985842131 5:2315086-2315108 TTATTTGTGTATAAATTGTAAGG + Intergenic
986902108 5:12448811-12448833 TTATTTGTATTTAAATTGCCTGG + Intergenic
987427316 5:17787850-17787872 GTATATGTATATAATTAGTATGG - Intergenic
987429272 5:17812475-17812497 ATATAGATATATAAATAGGAAGG - Intergenic
987547476 5:19331518-19331540 TTTTATTTATATAAATTTAAGGG - Intergenic
987574880 5:19712280-19712302 TTTTATTTCTATAAATTTGAGGG - Intronic
987615593 5:20269861-20269883 ATATATGTATACAAATGGAAAGG + Intronic
987869545 5:23597450-23597472 ATATATATATATATATTGTATGG + Intergenic
988151738 5:27391691-27391713 TTATATGTATATAGTTTTGGGGG - Intergenic
988740859 5:34068506-34068528 ATATACGTATATATATTTGAGGG - Intronic
989237599 5:39166942-39166964 TTTTATTTATATAAATTTAAGGG - Intronic
989338241 5:40344658-40344680 ATATATATATATTAATTGTATGG - Intergenic
989491751 5:42063749-42063771 TTATATGTACATTATTTGTATGG - Intergenic
989582236 5:43043584-43043606 ATAAATATATATAAATTAGACGG - Intergenic
989782278 5:45282129-45282151 TGATATGTATATAAGTTTAATGG + Intronic
990172355 5:53067274-53067296 TAATCTGTATAGAAATTGGTTGG + Intronic
990215202 5:53523684-53523706 TTACATGTTTATGAATTGGAAGG - Intergenic
990220894 5:53587118-53587140 TTATATATATATAACTCGGCCGG - Intronic
991076004 5:62538992-62539014 TTTTGTGTCTGTAAATTGGAAGG + Intronic
991601972 5:68360480-68360502 TTATATATATATAAATTGCAGGG - Intergenic
991678914 5:69118319-69118341 ATATATGTATATATATATGAAGG + Intronic
992120719 5:73589380-73589402 TTATATATATATATATTAGCCGG + Intergenic
992641611 5:78772902-78772924 ATATATGTATAAAAATTAGCCGG - Intergenic
992778671 5:80109331-80109353 ATATATATATATAAATTAGCCGG - Intergenic
992941502 5:81766908-81766930 ATATATGTATATATATTTAAGGG + Intergenic
993072286 5:83180146-83180168 TTATATTGATCTAAATTGAAAGG + Intronic
993199956 5:84803111-84803133 TTAAATGTATATATATTTGGTGG - Intergenic
993868172 5:93219320-93219342 TGATATGTATATAAAGTTCATGG - Intergenic
994037970 5:95224425-95224447 TTAAATGCAGAGAAATTGGATGG - Intronic
994442326 5:99824895-99824917 TTATATGTATATAGTTTTCACGG - Intergenic
994648168 5:102495733-102495755 TTATATCTAAATAAATCAGAAGG + Intronic
994679782 5:102871679-102871701 TTATATATATATAAAATAAAAGG - Intronic
995439601 5:112175736-112175758 GTATATGTATATATATATGAAGG + Intronic
996079497 5:119240833-119240855 TAAAATGTATATAAATGGAAGGG + Intronic
996120138 5:119662645-119662667 TTATATATATATATATGAGAAGG - Intergenic
996437858 5:123455388-123455410 ATATATATATATAAATGGAAAGG + Intergenic
996835951 5:127792542-127792564 ATATATGTATAAAAATTAGCTGG + Intergenic
998285845 5:140860159-140860181 ATATATGTATATATATATGATGG + Intronic
998292678 5:140929692-140929714 TTATATGAATATAATATGGAAGG + Intronic
998701458 5:144705345-144705367 TTATATGTATGTTAGTTGGCTGG - Intergenic
998898168 5:146822642-146822664 TTATATGTTGATAAATGGTATGG - Intronic
999441336 5:151603304-151603326 AGAGATGTATATCAATTGGAAGG + Intergenic
999458652 5:151739269-151739291 ATATATATATATAAATTAGTTGG + Intergenic
999605637 5:153312073-153312095 TTATAGGTAAATTATTTGGATGG + Intergenic
1000744821 5:165019623-165019645 TTATATGTTTATCACTTTGAGGG + Intergenic
1002354068 5:178609745-178609767 ATATATATATATAAATTAGTTGG + Intronic
1002968058 6:1987295-1987317 ATGTATGTATATAAATAGAAAGG - Intronic
1003486633 6:6585671-6585693 TTATATATATATATATATGAAGG + Intergenic
1004220292 6:13741159-13741181 ATATATGAATATAAATTAGCTGG + Intergenic
1004411271 6:15383589-15383611 TAATATGAATATAAATAGAAGGG - Intronic
1005112991 6:22306012-22306034 ATATATGTATATAAAATAAAGGG + Intergenic
1006235217 6:32624950-32624972 TTATATTTATAAAAACAGGAAGG + Intergenic
1007480278 6:42145214-42145236 TTATATGTATATTTTTTAGATGG + Intergenic
1007568739 6:42873839-42873861 ATATCTATATATAAATTAGATGG - Intergenic
1007670587 6:43549798-43549820 ATATTTTTATATAAATGGGAGGG - Intronic
1008037024 6:46756239-46756261 TTAAATGTCTGTTAATTGGAAGG + Intronic
1008080870 6:47193358-47193380 ATATATGTATATAAAAAGGGAGG + Intergenic
1008682765 6:53891684-53891706 GTAAATATATATAAATTGGCCGG + Intronic
1008866057 6:56211237-56211259 GTATATGTATATATAATGAAAGG + Intronic
1009307987 6:62116121-62116143 TTGTATGCATACAAACTGGAAGG + Intronic
1009717469 6:67417547-67417569 GTAGTTGTATATAAATAGGAAGG + Intergenic
1009911197 6:69930355-69930377 TTAGATATATCTAAATTTGATGG + Intronic
1010430900 6:75777587-75777609 ATATATATATATAAATTAGCTGG - Intronic
1010704046 6:79086765-79086787 TTATTTGAATATAAAATGAAGGG + Intergenic
1011867432 6:91847649-91847671 ATATATGTATATGAAATGAATGG + Intergenic
1012046203 6:94276788-94276810 ATATATGTATATATATTTGCAGG + Intergenic
1012098758 6:95001928-95001950 TTATCTGTATATAAGTTGGTTGG + Intergenic
1012510507 6:99995911-99995933 TTATTTTTATAATAATTGGAAGG + Intergenic
1012538576 6:100330778-100330800 TTATATATATATGAATTTGCAGG + Intergenic
1013152953 6:107464051-107464073 ATATATATATATAAATTAGCTGG - Intergenic
1013402552 6:109813129-109813151 TAAAATGTATATAAATTAAAAGG - Intronic
1013443943 6:110201830-110201852 AAATATTTATATAAATGGGAAGG + Intronic
1013491274 6:110648223-110648245 TTAAAGGTATATAGATTGAAGGG + Intronic
1013494825 6:110688341-110688363 ATATATATATATAAAATGCAGGG + Intronic
1013570029 6:111413362-111413384 TTTTAAGTATATCAATAGGAAGG + Intronic
1013706150 6:112836935-112836957 TAAGAGATATATAAATTGGAAGG - Intergenic
1013721159 6:113029785-113029807 ATATATGTATATATATATGACGG - Intergenic
1013721162 6:113029863-113029885 ATATATGTATATATATATGACGG - Intergenic
1014011426 6:116480449-116480471 TTATATATATTTTAAATGGAAGG - Intergenic
1014109501 6:117604327-117604349 TTATGTGTAGATAAAGTGGCTGG - Intergenic
1014751974 6:125267214-125267236 TTATATATATATATAATGGATGG - Intronic
1015065307 6:129019247-129019269 GAATAAGTATATAAATTGAATGG - Intronic
1015274797 6:131373139-131373161 GTAAATGTATATAAAATGGTTGG - Intergenic
1015375656 6:132507276-132507298 TTTTATTTATATAAATTTAAGGG - Intronic
1015506039 6:133989629-133989651 TTATCTGTATAAAAATTGGCAGG - Exonic
1015511475 6:134042040-134042062 TCAAATGTATATAAATGGGATGG + Intronic
1015861825 6:137689467-137689489 TTATATGTGCAAAATTTGGAAGG + Intergenic
1016605008 6:145910678-145910700 TAATATGCTTATAAATTGTAAGG - Intronic
1018051481 6:160012736-160012758 ATATATATATATAAATTAGCCGG - Intronic
1018425940 6:163680560-163680582 TTATAAATAAATAAATAGGAAGG - Intergenic
1018630619 6:165818971-165818993 TTCAATGTATATAAAATGTAAGG + Intronic
1020286030 7:6681534-6681556 ATATATATATATAAATTAGCCGG - Intergenic
1020394867 7:7703364-7703386 CTATAGGTAAATAAATTAGATGG - Intronic
1020712092 7:11619717-11619739 TTAAAAGTATGTAAATTGGGCGG - Intronic
1021421039 7:20444794-20444816 TTTTATGGTTATAATTTGGAGGG - Intergenic
1021778424 7:24076791-24076813 TTATATATATATATATATGATGG - Intergenic
1022023641 7:26425763-26425785 TTATCTTTCTATAAAATGGAGGG - Intergenic
1022765890 7:33410948-33410970 ATATATATATATATATTAGACGG - Intronic
1022852246 7:34275951-34275973 ATATATGTATATATATTTGCAGG - Intergenic
1022877292 7:34547640-34547662 GAATATGTATATAAAAAGGAAGG + Intergenic
1023154772 7:37237739-37237761 TAAAATGTATATACATTGAAAGG + Intronic
1024436102 7:49356506-49356528 TTAAATGTGTATAAATTTAAAGG + Intergenic
1026906235 7:74064452-74064474 ATGTATGTATATAAATTAGCTGG + Intronic
1027462479 7:78472297-78472319 GTATATGTATATAAATTTGCAGG - Intronic
1027699232 7:81449384-81449406 TTAAATGTATGTATAGTGGAGGG + Intergenic
1027994080 7:85401613-85401635 TTTTCTGTAGATAAATTGGCTGG + Intergenic
1028086926 7:86646741-86646763 TTCTATTTATTTAAATTGAATGG + Intronic
1028219973 7:88185726-88185748 TTAAAGGTAAAAAAATTGGAGGG - Intronic
1028322614 7:89478968-89478990 TTTTTTGTATATAAATTACATGG + Intergenic
1028552214 7:92081464-92081486 ATATATATATATAAATTAGCCGG - Intronic
1028818792 7:95181807-95181829 ATATATGTATATATATATGATGG - Intronic
1029291788 7:99507601-99507623 ATATATGTATATATATAGGCTGG + Intronic
1030007044 7:105130036-105130058 TTATATGTACTTACACTGGAAGG + Intronic
1030580089 7:111344095-111344117 CTATATTAAAATAAATTGGATGG - Intronic
1030656660 7:112175544-112175566 ACATATGTATATAAATGTGAAGG + Intronic
1030895656 7:115056701-115056723 TTATGTAATTATAAATTGGAGGG - Intergenic
1031109566 7:117591109-117591131 GTATATGTATATAAAATGGCTGG + Intronic
1031127984 7:117795853-117795875 TTATAGGTATATCAATTGTGAGG - Intronic
1031269029 7:119621322-119621344 TTATTTGTCTAGAAATGGGAAGG - Intergenic
1031290308 7:119926310-119926332 ATATATGTATGTTAATTGGCTGG + Intergenic
1031404830 7:121372446-121372468 TTATATTTATAAACATTGAAAGG - Intronic
1031408455 7:121413672-121413694 ATATATATATATAAAATGTAGGG - Intergenic
1031654043 7:124329456-124329478 CTATATATATATAAATTTAATGG - Intergenic
1031723868 7:125211336-125211358 TTATAAGTATATAAATTATTTGG - Intergenic
1031941960 7:127798519-127798541 TTATTTGTATAGAAGTTGGAGGG + Intronic
1032379445 7:131461433-131461455 ATGTATGTATACAAATTGTATGG + Intronic
1032646675 7:133832811-133832833 TTTTATGTATTGAAATTGTAGGG + Intronic
1033511943 7:142067929-142067951 ATATATATATATATATTTGAGGG - Intronic
1033834379 7:145291286-145291308 TTATATATATATGAATAGCAAGG + Intergenic
1033869974 7:145740600-145740622 GTATATATATATAAAATGTATGG + Intergenic
1034216046 7:149406548-149406570 TTATATATATATAAAATAGCTGG + Intergenic
1034855512 7:154542681-154542703 ATAAATGTTTATAAAATGGATGG - Intronic
1035531503 8:355577-355599 ATATATATATATAAATTAGTTGG - Intergenic
1036427180 8:8655351-8655373 TTAACTGTGTATAAATTAGATGG + Intergenic
1036483417 8:9157866-9157888 TTATATGTATATAAAGTTACAGG - Intronic
1036815495 8:11899507-11899529 ATATATATATATAAATTAGCTGG - Intergenic
1037259226 8:16988374-16988396 TTATTTGTTTGTAAATTGCACGG + Intergenic
1038517347 8:28198410-28198432 ATATATATATATTACTTGGAAGG + Intergenic
1038683343 8:29691818-29691840 TTATGGGTCTATAAACTGGAAGG + Intergenic
1039147031 8:34459340-34459362 GTATGTGTAGATAAAATGGATGG - Intergenic
1039350215 8:36756112-36756134 TTATGTGTATAAAAATAAGAGGG - Intergenic
1039483701 8:37895212-37895234 ATATATATATATATATTGGCAGG - Intronic
1039520356 8:38165501-38165523 ATATATGTAGAAAAATTGTAGGG - Intronic
1039768328 8:40655327-40655349 TTTTGTGTTCATAAATTGGAAGG + Intronic
1040026820 8:42789254-42789276 ATATATATATATAAATTAGCTGG - Intronic
1040447363 8:47508931-47508953 ATATATATATATAAAATGGAAGG - Intronic
1040489658 8:47907768-47907790 TTAAATGTATATAAATTGGCCGG - Intronic
1040725945 8:50381836-50381858 TTATATATATATATATATGAAGG + Intronic
1040843124 8:51805463-51805485 TTATATATATATAAAATGAATGG + Intronic
1040851672 8:51907180-51907202 GTATATCTATATAAATTATATGG + Intergenic
1040909648 8:52505005-52505027 TTATCTGTAAATAAAAAGGAAGG - Intergenic
1041248399 8:55911056-55911078 GTATATATATATAAATTAGCCGG - Intronic
1041554413 8:59136629-59136651 CTATATGTTTAAAATTTGGAGGG - Intergenic
1042360011 8:67871483-67871505 TTGTCTGTATATAAAATGTATGG + Intergenic
1043095296 8:75961779-75961801 ATATATTTATATAAATTTAAAGG + Intergenic
1043108365 8:76145645-76145667 CTATATCTATATAAAATGGCAGG - Intergenic
1043114353 8:76231236-76231258 TTAAATGTGTTTAAATTGAATGG + Intergenic
1043208953 8:77486280-77486302 ATATATGTATATATATATGATGG + Intergenic
1043211089 8:77518979-77519001 ATATATATATATAAATTAAAAGG + Intergenic
1043226439 8:77736689-77736711 TTTTATGTATATAATTGTGATGG + Intergenic
1043539765 8:81247344-81247366 TTCTATGTTTCTAAATTTGAAGG + Intergenic
1043661666 8:82750335-82750357 TTATATGTATATCAAATATATGG + Intergenic
1044443604 8:92248094-92248116 ATATATATATATAAATTAGCTGG - Intergenic
1044662791 8:94607883-94607905 TTATATATATATATATATGATGG + Intergenic
1044939299 8:97324348-97324370 TTATATGTCAATAAAATTGAGGG - Intergenic
1045762018 8:105620698-105620720 TGATTTTTATATAAATTGTAAGG + Intronic
1045991484 8:108314047-108314069 ATTTATATATATAAATTAGAAGG + Intronic
1046368159 8:113264400-113264422 TTATATATATATATATATGAAGG + Intronic
1046426992 8:114066926-114066948 TTTTATGTATATAAAATGATTGG - Intergenic
1046462726 8:114563157-114563179 ATATATGTAAATAAATATGATGG - Intergenic
1047593925 8:126357262-126357284 ATATATATATATAAAAAGGAGGG + Intergenic
1047941109 8:129828030-129828052 TTAAATGTATATAAAGAGAAAGG + Intergenic
1048495261 8:134930022-134930044 TCATAAGTATTTCAATTGGAAGG + Intergenic
1048659943 8:136587886-136587908 TTATATATTTATAAATAAGAAGG - Intergenic
1050003673 9:1105070-1105092 ATATATATATATAAAGGGGAAGG - Intergenic
1050003680 9:1105120-1105142 GTATATATATATAAAGGGGAAGG - Intergenic
1050070490 9:1807253-1807275 TAAAATGTATATAAATTCAAAGG - Intergenic
1050134776 9:2450320-2450342 ATATATGTATATATATATGAAGG - Intergenic
1050191418 9:3030363-3030385 TTATATATATATATATGTGATGG - Intergenic
1050420268 9:5456823-5456845 ATATATGTTTATAAATTGTGGGG + Intronic
1050710198 9:8453062-8453084 TTATTTGTGTATAAAATAGAGGG + Intronic
1050814983 9:9799120-9799142 TTTAAAATATATAAATTGGAGGG - Intronic
1050881903 9:10711206-10711228 TTATTTCTATATAATTTTGATGG + Intergenic
1051207012 9:14698715-14698737 ATATATATATATATATTTGAGGG - Intergenic
1051348489 9:16174644-16174666 ATATATGTATATAAAATTTAAGG + Intergenic
1051388501 9:16538240-16538262 ATATATGTATATAATTAAGAAGG - Intronic
1051733654 9:20175017-20175039 TTATATATATATATATATGATGG + Intergenic
1051778786 9:20665897-20665919 TTATATATATATATTTTAGACGG + Intronic
1052061714 9:23967584-23967606 TTTTATTTATATAAATTTAAAGG + Intergenic
1052137561 9:24933288-24933310 TTTTATTTATTTAATTTGGAAGG + Intergenic
1052711190 9:32058175-32058197 TTATATGTCTAGAAATGGAATGG - Intergenic
1052932750 9:34068943-34068965 ATATATATATATAAATTAGCTGG + Intergenic
1054817926 9:69493541-69493563 TTATATCTTTATAAAATAGAAGG - Intronic
1054895199 9:70302507-70302529 ATATATATATATAAATTAGCTGG + Intronic
1055008004 9:71530896-71530918 TTATATATATATATATTTAAAGG + Intergenic
1055089546 9:72348737-72348759 ATATATATATATATATAGGAAGG + Intergenic
1055380447 9:75700997-75701019 TAATATGTTTATAATTTTGATGG - Intergenic
1055916453 9:81406584-81406606 ATATATATATATAAATTATAAGG - Intergenic
1056109269 9:83378437-83378459 ATATATATATATAAATTAGCCGG - Intronic
1056878042 9:90355957-90355979 TAACATGAATATAGATTGGAAGG + Intergenic
1057485689 9:95481697-95481719 TTATTTGCATATAAATAGGTTGG + Intronic
1057600928 9:96456428-96456450 TTATGTGTATCTAAGTGGGAGGG + Intronic
1058052521 9:100421171-100421193 TTATATGTAAATCAATTTGATGG - Intergenic
1058148137 9:101434126-101434148 TAATATGTATATAAATCTGGAGG + Intronic
1058172025 9:101693257-101693279 ATATATATATATATATTGCACGG + Intronic
1058251926 9:102709377-102709399 CTATATGTATATAAGTTTGTAGG + Intergenic
1058570115 9:106332584-106332606 ATATATGTATCTATATTAGATGG - Intergenic
1058724678 9:107790844-107790866 TTATTTGGATAGAAATTGGACGG + Intergenic
1058792262 9:108460777-108460799 TTATATGCCAATAAATTAGATGG + Intergenic
1060163153 9:121385488-121385510 ATATATATATATAAATTTGCTGG + Intergenic
1060293167 9:122323043-122323065 TAAAATCTAAATAAATTGGAAGG + Exonic
1060622439 9:125080168-125080190 TGATATGTATATAAAATGCCTGG - Intronic
1060753853 9:126194598-126194620 TCATATGTCTATAATGTGGATGG + Intergenic
1060876457 9:127087418-127087440 TTTTGTGTATATAAAAGGGAGGG - Exonic
1062171098 9:135135187-135135209 TTATATATATATATATGGGCAGG + Intergenic
1062655260 9:137601200-137601222 ATATATATATATAAATTAGCTGG - Intergenic
1203415714 Un_KI270582v1:5437-5459 ATATATATATATATATTTGATGG + Intergenic
1185637984 X:1568855-1568877 ATATATATATATAAATTAGCCGG + Intergenic
1185849746 X:3474267-3474289 TTGTATGTAGAAAAATTGGTAGG + Intergenic
1186008386 X:5100929-5100951 TTTTATTTACATAAATTAGAGGG - Intergenic
1186019839 X:5242023-5242045 TTATATAAACATAAATTGAACGG + Intergenic
1186376538 X:9008740-9008762 TTATATGTATATAAATATCTAGG - Intergenic
1186801666 X:13098874-13098896 TTATTTGAATATAAACTGGAGGG + Intergenic
1187065615 X:15834431-15834453 ATATATATATATATTTTGGAAGG - Intronic
1187124497 X:16441485-16441507 TGATATGTAGAGAAATGGGAAGG - Intergenic
1187537189 X:20152747-20152769 TTATATGTTCACAAAATGGAAGG - Exonic
1187563988 X:20430147-20430169 ATATATGTATATAAATAACAAGG - Intergenic
1187633458 X:21200846-21200868 ATATATGTATATATATATGAAGG - Intergenic
1187786792 X:22898374-22898396 TTATATATATATATATTTGGAGG + Intergenic
1188260822 X:28021559-28021581 TTTTATTTGTATAAATTTGAAGG + Intergenic
1188346654 X:29075084-29075106 TTATATGTATATAAAACCTAAGG - Intronic
1188996773 X:36896558-36896580 TTACCTGTATTTAAATGGGATGG + Intergenic
1189111173 X:38291135-38291157 ATATATATATATAAAATGAAGGG + Intronic
1189611924 X:42746168-42746190 ATATATATATATAAATTAGTTGG + Intergenic
1189661541 X:43305320-43305342 TTTTTGGTATATAACTTGGAAGG - Intergenic
1189902655 X:45723019-45723041 ATATATATATATAAATTAGCAGG + Intergenic
1191929372 X:66352368-66352390 TAAAATGTATATAAATTTCATGG + Intergenic
1192387639 X:70688811-70688833 ATATATATATATAATTTGGGAGG + Intronic
1192967820 X:76197967-76197989 ATATATATATATAAATATGATGG - Intergenic
1193195022 X:78621133-78621155 TTTTATTTGTATAAATTTGAGGG - Intergenic
1193513641 X:82436185-82436207 ATATATATATATAAATCAGACGG + Intergenic
1193781738 X:85711461-85711483 TTATATATATATATATATGATGG - Intergenic
1194012358 X:88578305-88578327 ATATATGTATATATATATGATGG + Intergenic
1194404900 X:93484517-93484539 TGATATCTATGTAAATAGGAGGG + Intergenic
1194499660 X:94665614-94665636 TTATAAGTATAGAAGTTGTATGG + Intergenic
1194597618 X:95878240-95878262 TTTTATGTTTATAAATTTAAGGG - Intergenic
1194687289 X:96937446-96937468 ATAAATGGATATAAATTGGGAGG - Intronic
1194740680 X:97570069-97570091 ATATATATATATATATTAGAAGG - Intronic
1194742940 X:97596943-97596965 ATATATGTATATATATTTGTTGG + Intronic
1195034821 X:100962794-100962816 ATACATGTTTATAGATTGGAAGG + Intergenic
1195493750 X:105505352-105505374 TTATATTTATGTAAAATGGTAGG - Intronic
1196257088 X:113533351-113533373 TTATATATACATAAAATAGAAGG + Intergenic
1196258975 X:113555335-113555357 CTATATGTAAGTATATTGGATGG - Intergenic
1196466821 X:115980596-115980618 TTATATATATATATATAGGCTGG - Intergenic
1196596622 X:117553165-117553187 TTATTTTTAAATAAAATGGATGG + Intergenic
1196669683 X:118352309-118352331 ATATATATATATAAATTAGCTGG - Intronic
1196839766 X:119848751-119848773 TTACATTTATATGAAATGGAGGG + Intronic
1197140904 X:123116504-123116526 TAAAATCTAAATAAATTGGAAGG - Intergenic
1197171631 X:123441297-123441319 GCATATGTATATAAATTTGGGGG + Intronic
1197189860 X:123634163-123634185 TTATTTGTATATAAATATGGGGG + Intronic
1197475817 X:126923500-126923522 ATATATGTATATATATATGATGG - Intergenic
1197564721 X:128068496-128068518 GTATATCTCTATAAATTGTATGG - Intergenic
1197765639 X:130057880-130057902 ATATATATATATAAAGTTGAGGG + Exonic
1198147736 X:133874402-133874424 ATATATGTGCATAAAATGGAAGG - Intronic
1198409851 X:136355537-136355559 ATATATATATATAACATGGACGG + Intronic
1198724443 X:139662615-139662637 TTACATGTATATAATGTGTAGGG + Intronic
1199150498 X:144479362-144479384 TTAAATGAATATATTTTGGAAGG - Intergenic
1199270946 X:145882001-145882023 TCATATGAATTTAATTTGGAGGG - Intergenic
1199871693 X:151904186-151904208 TTATATGTACAGAAATTTGTGGG + Intergenic
1200714585 Y:6523591-6523613 TTAAAAGTATAAAAATGGGATGG - Intergenic
1200905970 Y:8483237-8483259 TAATATGAATATCAATTGGCAGG + Intergenic
1201019240 Y:9637567-9637589 TTAAAAGTATAAAAATGGGATGG + Intergenic
1202117575 Y:21485977-21485999 TTAAAAGTATAAAAATGGGATGG - Intergenic
1202160712 Y:21932814-21932836 AAATATATATATATATTGGATGG - Intergenic
1202230645 Y:22653561-22653583 AAATATATATATATATTGGATGG + Intergenic
1202312512 Y:23542604-23542626 AAATATATATATATATTGGATGG - Intergenic
1202558290 Y:26127990-26128012 AAATATATATATATATTGGATGG + Intergenic