ID: 1175084435

View in Genome Browser
Species Human (GRCh38)
Location 20:56446752-56446774
Sequence GATTCAACAGTCTCTGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175084435_1175084446 23 Left 1175084435 20:56446752-56446774 CCAACCCCAGAGACTGTTGAATC 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1175084446 20:56446798-56446820 CAGGATTTTTAAAAGCCCTCAGG 0: 1
1: 0
2: 1
3: 38
4: 306
1175084435_1175084441 -10 Left 1175084435 20:56446752-56446774 CCAACCCCAGAGACTGTTGAATC 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1175084441 20:56446765-56446787 CTGTTGAATCAGGTCTAGATGGG 0: 1
1: 0
2: 0
3: 6
4: 75
1175084435_1175084443 4 Left 1175084435 20:56446752-56446774 CCAACCCCAGAGACTGTTGAATC 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1175084443 20:56446779-56446801 CTAGATGGGGCCCAAACATCAGG 0: 1
1: 0
2: 0
3: 21
4: 60
1175084435_1175084442 -9 Left 1175084435 20:56446752-56446774 CCAACCCCAGAGACTGTTGAATC 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1175084442 20:56446766-56446788 TGTTGAATCAGGTCTAGATGGGG 0: 1
1: 0
2: 1
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175084435 Original CRISPR GATTCAACAGTCTCTGGGGT TGG (reversed) Intronic
901670903 1:10856049-10856071 CAGTCCACAGCCTCTGGGGTGGG + Intergenic
906208056 1:43997481-43997503 GCCTCACCAGTCTCTGCGGTGGG + Intronic
910104446 1:83616380-83616402 GATTCAACAGCCTGGGGTGTGGG - Intergenic
911649153 1:100367768-100367790 GCTTCAACATACTGTGGGGTGGG + Intronic
911669489 1:100592153-100592175 GCTTTAACAGTCTATGGTGTTGG + Intergenic
913059042 1:115187918-115187940 GATTCAACAATGTCTGGAATGGG + Intergenic
913572381 1:120133645-120133667 GAGTCAAAAGTCACTGGGGCAGG + Intergenic
915388105 1:155515385-155515407 GATTCAACAAACTCTTGGGAAGG - Intronic
918191695 1:182181718-182181740 CATTCACCAGGCTCTGGGCTGGG - Intergenic
920449795 1:206051303-206051325 GGTTCAAAAGTCTGTGGTGTAGG + Intronic
923456829 1:234171973-234171995 CAGTCATCAGTTTCTGGGGTTGG - Intronic
923487233 1:234445142-234445164 GCATCAACAGCCTCTGGTGTGGG + Intronic
1069947668 10:71998992-71999014 CATTCAGCAGCCTCTGGGCTGGG + Intronic
1073110717 10:101061666-101061688 GATTTTACAGTCCCTGGCGTCGG - Intergenic
1079477290 11:20844493-20844515 TTTTCAAGAGTCTCTGGGGAGGG - Intronic
1080687911 11:34530787-34530809 GATGGATGAGTCTCTGGGGTTGG + Intergenic
1081570926 11:44290306-44290328 GATTGAGAAGTCTTTGGGGTAGG + Intronic
1081591969 11:44429616-44429638 CTTGCACCAGTCTCTGGGGTAGG - Intergenic
1086363771 11:86087510-86087532 CATTCATCAATCTCTGGGGAGGG + Intergenic
1087305568 11:96485881-96485903 GATTTTAAAGTCTCTGGAGTGGG - Intronic
1089143999 11:116311157-116311179 GATGCAACAGGCTATGGGGTGGG + Intergenic
1092783757 12:12009951-12009973 GATTAAACAATCTCTTGGCTGGG - Intergenic
1093803042 12:23397010-23397032 GATTCTACAGTCTGTGGAATGGG - Intergenic
1095896166 12:47282428-47282450 GTTTCAACAGTGCCTGCGGTGGG - Intergenic
1095950049 12:47776849-47776871 GACTCAGCAGTTTCTGGGTTAGG - Intronic
1096423730 12:51483056-51483078 GACTCAACAATACCTGGGGTGGG - Intronic
1097052268 12:56230637-56230659 GGTTCACTGGTCTCTGGGGTAGG - Exonic
1097699555 12:62806366-62806388 TATGCAACAGGCTCTGGAGTAGG + Intronic
1106285435 13:28314450-28314472 GATTCAACAGTATCTGGGCCAGG + Intronic
1110213340 13:72998516-72998538 TATCTCACAGTCTCTGGGGTTGG + Intronic
1112519921 13:100086207-100086229 AATTCAACAGCCCCTGGGCTTGG - Intergenic
1114154869 14:20089814-20089836 GAAACAACAGACTCTGGGATGGG + Intergenic
1120204814 14:81576577-81576599 GACTCAAAAAACTCTGGGGTGGG - Intergenic
1121886871 14:97551084-97551106 TATTCTTCAGTCTCTGGGCTTGG + Intergenic
1122096212 14:99374864-99374886 GAGGGGACAGTCTCTGGGGTGGG - Intergenic
1122276181 14:100591925-100591947 GATTGAACAGTACCTGGGTTGGG - Intergenic
1122867739 14:104615779-104615801 AATTCTTCAGTTTCTGGGGTAGG + Intergenic
1124422343 15:29533807-29533829 GATTCAACACTCTCTTGGAAAGG + Intronic
1127557723 15:60104547-60104569 GTTCCAAAAGTCTATGGGGTTGG + Intergenic
1128335738 15:66784703-66784725 CATGCAATAGTCTCTAGGGTAGG - Intergenic
1133626796 16:7577605-7577627 CATTTACCAGTCTCTGGGGATGG + Intronic
1140689989 16:77472830-77472852 GCTTCATCAGTCTGTGGTGTAGG + Intergenic
1143170813 17:4929157-4929179 AAATCAACAGCCTCTGGGCTCGG + Intergenic
1143950597 17:10629550-10629572 GTTTCTACAGTCCCTGGGGGGGG + Intronic
1145789678 17:27618428-27618450 CATTAAAAAGTCTCTGGGCTAGG + Intronic
1146797411 17:35792470-35792492 CATTCTACAGTGTCTGGGGCTGG - Intronic
1150536722 17:66050439-66050461 AATACAACAGTCTCTGGATTGGG - Intronic
1151997616 17:77620065-77620087 GATTCATCAGGGTCTGGGGAAGG + Intergenic
1152781027 17:82227530-82227552 GATTCATCAGTTTCTGAGGAGGG - Intergenic
1153512890 18:5874539-5874561 GATTCAACAGTCCTAGGGGTAGG + Intergenic
1153678999 18:7482822-7482844 GATTTAACAAACTATGGGGTAGG + Intergenic
1153684180 18:7528809-7528831 AATTCAAAAGTCTCTGGTCTTGG + Intergenic
1159901547 18:74052210-74052232 GTTTCAACAGTCCCTGGGTTAGG + Intergenic
1164444784 19:28307859-28307881 GATTCAGCACTCTCTGGAGCAGG - Intergenic
1166231349 19:41427240-41427262 GGTTCCCCAGTCCCTGGGGTTGG - Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
925701790 2:6646250-6646272 GAATCTACAGTCTTTGGGATAGG + Intergenic
926823955 2:16883690-16883712 GGTGCACCAGTCACTGGGGTAGG - Intergenic
929503893 2:42513331-42513353 GATTCAGCAATCACTGGGGTGGG + Intronic
930296232 2:49557887-49557909 CATTCACCAGTCTCAGGGGCTGG + Intergenic
931534570 2:63259306-63259328 GAATCAATAACCTCTGGGGTTGG - Exonic
933171726 2:79132695-79132717 GAGGCAACAGTCTCTAGGCTGGG + Intergenic
933946598 2:87291636-87291658 GTTTCATCAGTCTCTGTGGAAGG + Intergenic
933970429 2:87465488-87465510 AATTCAGCAGTCTCTGGGACAGG - Intergenic
936333594 2:111569905-111569927 GTTTCATCAGTCTCTGTGGAAGG - Intergenic
939318291 2:140580822-140580844 ACTTCAACAGTCTATGGGGAGGG + Intronic
939613627 2:144337905-144337927 AATTCAACAGTATTTGGGCTGGG - Intergenic
945077624 2:206056246-206056268 GTTTCACCAGTCTCTGCAGTCGG + Exonic
946646914 2:221847160-221847182 GATTGCAAAGTCTCTGGAGTTGG + Intergenic
947736806 2:232459407-232459429 AAATCTGCAGTCTCTGGGGTTGG - Exonic
1170775546 20:19371806-19371828 GCTTCCTCAGACTCTGGGGTAGG - Intronic
1170808793 20:19657330-19657352 AGTTCAACAGGCTCTTGGGTAGG + Intronic
1172393363 20:34581721-34581743 GAGTCAGGAGTCTCTAGGGTAGG - Intronic
1172525121 20:35596085-35596107 GATTCAGCAGGGCCTGGGGTGGG - Intergenic
1172707404 20:36892106-36892128 GATTCCTCTGTCACTGGGGTAGG + Exonic
1175084435 20:56446752-56446774 GATTCAACAGTCTCTGGGGTTGG - Intronic
1175439135 20:58978560-58978582 GATACAACAGCCTTGGGGGTGGG - Intergenic
1176100853 20:63363882-63363904 GACTGAACAGTCTCTGAGGGTGG - Intronic
1178859125 21:36274517-36274539 GATTAAGCAGTCACTGAGGTGGG + Intronic
1179880279 21:44290737-44290759 GATTCAGCAGGCGCTGAGGTCGG + Intronic
1181138135 22:20783837-20783859 GAATCAAGAGACTGTGGGGTCGG + Intronic
1184487577 22:44790135-44790157 AATTTAGAAGTCTCTGGGGTTGG + Intronic
949627782 3:5887440-5887462 GATTCAAAAATCTCTGGGTAAGG - Intergenic
950795084 3:15504040-15504062 GATTGAACCCTCTCTGTGGTCGG - Intronic
951753127 3:26059270-26059292 GATTCAGCAGTTACTGTGGTTGG + Intergenic
952836783 3:37609536-37609558 GATTTAACAGTGTCATGGGTGGG - Intronic
954799811 3:53180748-53180770 GATTGGACAGTCTCGAGGGTGGG - Intronic
957598221 3:82295905-82295927 TATTCAACAGGCTCTGAGCTAGG - Intergenic
960246081 3:115401903-115401925 GATTCAACAGGATCTGTGCTGGG - Intergenic
960578937 3:119257275-119257297 GATTCAACAGAAACTGGGCTGGG - Intergenic
962381006 3:134898070-134898092 GATTCCGGAGTCTGTGGGGTGGG + Intronic
964045615 3:152321968-152321990 GAATAAACAGTCTCTGTGTTTGG - Intronic
969709612 4:8835197-8835219 AATTCTAGACTCTCTGGGGTGGG + Intergenic
970601986 4:17647852-17647874 GGGACAACAGTCTCTGGGGTGGG + Intronic
971310433 4:25521513-25521535 GATTCAAAACTCTTTGGGGCTGG + Intergenic
973921025 4:55685252-55685274 GATTCATTAGGCACTGGGGTGGG - Intergenic
976055571 4:81061702-81061724 GATTTAACATTTTCTGGGATTGG - Intergenic
977943026 4:102878535-102878557 GTTTCATCAGTCTCTTGGGCAGG + Intronic
984937559 4:184902371-184902393 GATTTAAAAGACTCTGGGGCAGG + Intergenic
990511012 5:56488966-56488988 CATTCAACAGACCATGGGGTGGG + Intergenic
992126876 5:73651132-73651154 GTTTTAACAGTCACTGGGTTTGG + Intronic
993884621 5:93401103-93401125 GATTCAGGAGGCTTTGGGGTGGG + Intergenic
994006326 5:94841447-94841469 AATTCCACAGTGTTTGGGGTGGG - Intronic
1001231218 5:169990466-169990488 GATGCAGCAGGCTCTGGGATCGG - Intronic
1003563606 6:7203934-7203956 GATCCCACAGTCTCTGATGTGGG - Intronic
1004412498 6:15394168-15394190 CATTCAACATTCTCTGGGAAAGG - Intronic
1004884192 6:20036155-20036177 GATTCAGAGGTCTCTGGGTTGGG + Intergenic
1008976666 6:57435101-57435123 GAATAAAAAGTCTCTGGGGATGG + Intronic
1012572617 6:100748586-100748608 GATTCAACTGTGTCTGAGGCAGG - Intronic
1016993334 6:149944267-149944289 AATCCAGCAGTATCTGGGGTGGG + Intronic
1017880360 6:158558808-158558830 AATTTAACAGGCTCCGGGGTTGG + Intronic
1020510570 7:9051483-9051505 TATTCAACATTCTCTGGGCATGG + Intergenic
1027348752 7:77288789-77288811 GAGCCCACAGTCTCTGGTGTGGG - Intronic
1029514602 7:101017631-101017653 GAGTCAACAGTCTCCAGGGTGGG - Exonic
1032299245 7:130671110-130671132 GGTACAAAAGTCTCTGGGATTGG - Intronic
1032591528 7:133196510-133196532 AAATCCACAGGCTCTGGGGTTGG + Intergenic
1034333976 7:150308590-150308612 GATTCAGAAGACTCTGAGGTTGG - Intronic
1034468789 7:151245134-151245156 GATGCTTCAGTCTTTGGGGTGGG - Intronic
1036461898 8:8960749-8960771 GGTTCCACAGTCTCTAGGGCAGG + Intergenic
1038370552 8:26985600-26985622 GCTTCTACAGTCTGTGGGTTTGG + Intergenic
1039923022 8:41906463-41906485 GAGTAAAGAGTCCCTGGGGTGGG + Intergenic
1041579055 8:59435425-59435447 GCATCAAAAGTCTCTTGGGTTGG - Intergenic
1045872493 8:106942143-106942165 GCTTCAACAAACTCTGGGGATGG + Intergenic
1046718679 8:117595041-117595063 AATTCATCTGTCTCTGGGGATGG - Intergenic
1047201715 8:122772845-122772867 GATCCCACAGTCTTTGGGGGTGG + Intergenic
1048844203 8:138591393-138591415 CATTCTGCAGTCTCAGGGGTAGG - Intronic
1055364306 9:75526957-75526979 GATCCAAGAGTCTCTGGCCTTGG - Intergenic
1187681959 X:21776991-21777013 GATTCTTCAGACTCAGGGGTAGG - Intergenic
1187958457 X:24544206-24544228 GATTCAACAGTGTCTATGGAAGG - Intergenic
1188675895 X:32938586-32938608 AATTCTACAGTAACTGGGGTTGG - Intronic
1189446984 X:41088999-41089021 AATTAATCAGTCTCTGGGGGTGG - Intronic
1191603298 X:63033874-63033896 GATTCAACAATCTGTGTGTTGGG + Intergenic
1195618584 X:106931708-106931730 GATACAACAGGCTATGTGGTGGG - Intronic
1196294204 X:113980192-113980214 GGTTCAGAAGTCTCAGGGGTTGG - Intergenic
1199244109 X:145583061-145583083 GATTAGACAGTATCTGTGGTTGG + Intergenic