ID: 1175092660

View in Genome Browser
Species Human (GRCh38)
Location 20:56517821-56517843
Sequence AACGCAGGCCCTGCCTCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175092654_1175092660 -7 Left 1175092654 20:56517805-56517827 CCATTTCCTCCCCTGGAACGCAG 0: 1
1: 0
2: 1
3: 44
4: 364
Right 1175092660 20:56517821-56517843 AACGCAGGCCCTGCCTCATCAGG 0: 1
1: 0
2: 0
3: 10
4: 146
1175092650_1175092660 11 Left 1175092650 20:56517787-56517809 CCACTCAGGTTCCTGTGCCCATT 0: 1
1: 0
2: 4
3: 16
4: 225
Right 1175092660 20:56517821-56517843 AACGCAGGCCCTGCCTCATCAGG 0: 1
1: 0
2: 0
3: 10
4: 146
1175092653_1175092660 -6 Left 1175092653 20:56517804-56517826 CCCATTTCCTCCCCTGGAACGCA 0: 1
1: 0
2: 1
3: 15
4: 192
Right 1175092660 20:56517821-56517843 AACGCAGGCCCTGCCTCATCAGG 0: 1
1: 0
2: 0
3: 10
4: 146
1175092651_1175092660 0 Left 1175092651 20:56517798-56517820 CCTGTGCCCATTTCCTCCCCTGG 0: 1
1: 0
2: 3
3: 49
4: 453
Right 1175092660 20:56517821-56517843 AACGCAGGCCCTGCCTCATCAGG 0: 1
1: 0
2: 0
3: 10
4: 146
1175092648_1175092660 30 Left 1175092648 20:56517768-56517790 CCGGCTCTACATGGGACAGCCAC 0: 1
1: 0
2: 3
3: 9
4: 142
Right 1175092660 20:56517821-56517843 AACGCAGGCCCTGCCTCATCAGG 0: 1
1: 0
2: 0
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175092660 Original CRISPR AACGCAGGCCCTGCCTCATC AGG Intronic
901529514 1:9844358-9844380 AGCCCAGGCCCTGCCTCCTTGGG + Intergenic
901654107 1:10759568-10759590 AATCCAGGCCATGCCTCCTCAGG - Intronic
903033872 1:20481942-20481964 AACTCAGCCCCTGCCTCATAGGG - Intergenic
905534609 1:38710836-38710858 AGCGCAGGCCCTCCCCCAACTGG + Intergenic
905771654 1:40641891-40641913 GAGCCAGGTCCTGCCTCATCTGG - Exonic
906809127 1:48808492-48808514 AAATTTGGCCCTGCCTCATCAGG - Intronic
909547495 1:76863782-76863804 CACACAGACTCTGCCTCATCAGG - Intergenic
912452091 1:109773463-109773485 AAGGCAGGCCCTGTCTCAACTGG + Intronic
913149218 1:116023981-116024003 ATCACAGGCCCTGTATCATCTGG - Intronic
919359485 1:196572997-196573019 AAGGCAGGCCTTGTCTCTTCGGG + Intronic
922485804 1:225972341-225972363 GACACAGGTCCTGCCTCATACGG - Intergenic
922784786 1:228277472-228277494 AAGGGAGGCCCTGCCACACCCGG - Intronic
1063581939 10:7316113-7316135 AACGCATGACCTCCCTCAACAGG + Intronic
1064126465 10:12665860-12665882 ACTGCAGGCCCTGCGTCAGCAGG - Intronic
1065430105 10:25645234-25645256 CACGAAGGCTCTGCCTGATCTGG - Intergenic
1067054961 10:43045024-43045046 CTCGCAGGCCCTGCCTCTTTGGG - Intergenic
1067059042 10:43068431-43068453 ACCGCAGGCCCAGGCTCCTCTGG + Intergenic
1067248013 10:44562391-44562413 AAGGCAGGCCCCGCCTCTTTAGG - Intergenic
1071718595 10:88120726-88120748 AACGCAGACCCAGCCTTAGCTGG - Intergenic
1074809763 10:117091909-117091931 GACACAGTCCCTGCCTCAACTGG - Intronic
1077442934 11:2577128-2577150 AACGGAGACCCAGCCTCACCAGG - Intronic
1083596073 11:63918783-63918805 AACTGAGGCCCTGCCTAATAGGG - Intergenic
1083890664 11:65594247-65594269 AGCCCAGGCCCTGCCCCTTCTGG + Intronic
1084003790 11:66312971-66312993 CTCGCAGGCCCCGCCTCATTCGG - Intergenic
1084512840 11:69616832-69616854 AACCCAGGCCCTGCCTCACAGGG + Intergenic
1084591361 11:70092564-70092586 AATGCAGGCTCTGGCTCAGCTGG + Intronic
1085023963 11:73225878-73225900 CACTCAGGCCCTGGCTGATCTGG - Intronic
1086220527 11:84437698-84437720 AAGGCAGCGCCTGCCTCACCCGG - Intronic
1088794019 11:113251897-113251919 ACCACAGCCCCTCCCTCATCAGG + Intronic
1089296972 11:117475387-117475409 GACCCAGGCCCTGCAACATCTGG + Intronic
1090344808 11:126061822-126061844 AATGCCTGCCCTTCCTCATCAGG - Intronic
1091891225 12:4056159-4056181 AACGAAGGCCCTGCCCCAACTGG - Intergenic
1092291252 12:7160534-7160556 AAGGCAGGACCTGCCCCACCTGG - Intergenic
1095488193 12:42706192-42706214 AGCCCAGGCCCTGCCCCAGCTGG + Intergenic
1100219083 12:92484450-92484472 AAAGATGGCCCTGCCTCATGAGG + Intergenic
1100299345 12:93292917-93292939 AGCAAAGGCCCCGCCTCATCAGG - Intergenic
1100680113 12:96909269-96909291 AACGCAGTCCCTTCCTTACCTGG - Intronic
1102199198 12:111045807-111045829 AACACAGCCCCTACCTCATAGGG + Intronic
1102330032 12:112021153-112021175 AACACAGTCCCTGCCACATGGGG - Intronic
1102583382 12:113906630-113906652 AAGGCTGGTCCTGCCTCGTCGGG + Intronic
1103534705 12:121626644-121626666 TACGCGGGCCCGGCCTCACCCGG - Exonic
1117400092 14:55351260-55351282 CACGCTGGCCCTGCCGCTTCAGG - Exonic
1118781102 14:69008388-69008410 AACAAAGCCCCTGCCTCATGGGG + Intergenic
1121671592 14:95714355-95714377 AACGCAGACCCGGCCCCAGCTGG + Intergenic
1123456418 15:20430374-20430396 AAGGCAGTGGCTGCCTCATCTGG + Intergenic
1123661647 15:22569983-22570005 AAGGCAGTGGCTGCCTCATCTGG - Intergenic
1124262555 15:28205526-28205548 AAGGCAGTGGCTGCCTCATCTGG + Intronic
1124315446 15:28664216-28664238 AAGGCAGTGGCTGCCTCATCTGG - Intergenic
1125432231 15:39607137-39607159 AGCTCAGCCCCTGCCTCCTCAGG + Intronic
1125433796 15:39625126-39625148 AAGGCAAGCCCTGCCTCACCCGG - Intronic
1128315617 15:66657472-66657494 ACCCCAGGCCCTTCCTCTTCAGG + Intronic
1132463845 16:68601-68623 AGCCCAGGCCCAGCCCCATCAGG + Intronic
1132606858 16:797224-797246 TACCCTGGCCCTGCCTCATGAGG - Intronic
1132940875 16:2507485-2507507 AACGCGGACCCGGCCTCAGCGGG - Intronic
1136027901 16:27481752-27481774 GACGCAGCCCCTGCTGCATCTGG + Intronic
1136383648 16:29909475-29909497 AATACAAGCCCTTCCTCATCTGG - Intronic
1145766033 17:27458745-27458767 AACCCAGGCCCTGCCTTTTCAGG - Intronic
1147349375 17:39828201-39828223 AAGGCACAGCCTGCCTCATCAGG - Intronic
1148570913 17:48668225-48668247 ATCCCAGGCCCGGCATCATCTGG - Intergenic
1149609948 17:57952949-57952971 AAGGCAGGCCAGGCCTCCTCTGG + Intronic
1150076585 17:62197577-62197599 AAATCAGCCCCTGCCTCATGAGG - Intergenic
1151475364 17:74341983-74342005 AGCCCAGGCCCTCCCTCACCTGG - Exonic
1152801734 17:82333825-82333847 AACCCAGCTCCTTCCTCATCTGG - Exonic
1153969467 18:10212341-10212363 AAAGAAGACCCTGTCTCATCTGG - Intergenic
1154167955 18:12029946-12029968 AACCAAGGCTCTGCCTCAACAGG - Intronic
1158015412 18:52777320-52777342 AACTCAGGCCTTGCCTTCTCAGG + Intronic
1159058224 18:63488131-63488153 AATGGAGGCCCTCCTTCATCTGG + Intronic
1160342194 18:78099029-78099051 AACAAAGACCCTGTCTCATCTGG + Intergenic
1161064523 19:2231115-2231137 AACCCAGGCCCTGACTGCTCAGG - Exonic
1163935233 19:20436437-20436459 CACACAGCCCCTGCTTCATCTGG + Intergenic
1164553486 19:29232263-29232285 AACTCAGGCCCTGTCTAAACCGG - Intergenic
1165409234 19:35648630-35648652 ATCGCAGGCCCTATCTCATAGGG - Intronic
1167515671 19:49921868-49921890 AATGCAGGAGCTGCCTCCTCTGG + Intronic
1168280808 19:55304625-55304647 AACGCAGACGCTGCCTTCTCGGG + Exonic
1168635586 19:57993839-57993861 AACCCAGGGCATGCCTCACCAGG + Intronic
926008872 2:9393114-9393136 AAAGCAGGCCCTGCTTCCCCGGG + Intronic
926976432 2:18520961-18520983 AGAGAAGGCCCTGCCTCATTTGG + Intergenic
927207225 2:20618264-20618286 AAGTCAGGCCCTGCCTCTCCAGG - Exonic
931256595 2:60579604-60579626 AAAGCAGGCCCTGCTTTAGCAGG - Intergenic
932401008 2:71481289-71481311 AGAGGAGGACCTGCCTCATCAGG - Intronic
941760572 2:169237994-169238016 AGAGAAGGCCCTACCTCATCTGG - Intronic
945022296 2:205585691-205585713 CACTTAGGCCCTGCCTCTTCAGG + Intronic
947446216 2:230164553-230164575 AACCGAGGCCCTGCCCCATAAGG - Intergenic
1168963081 20:1881949-1881971 AAAGCAGTCCCTGCCTCACTTGG + Intergenic
1174085710 20:48005998-48006020 CATGATGGCCCTGCCTCATCGGG - Intergenic
1175092660 20:56517821-56517843 AACGCAGGCCCTGCCTCATCAGG + Intronic
1175418683 20:58817708-58817730 AAATCAGGCCCAGCCTCATGTGG - Intergenic
1175925310 20:62468541-62468563 AACGCTGCCCCTGCTTCATCTGG + Intronic
1176370909 21:6060897-6060919 ATGGCAGCCCCTGCCTCATGCGG - Intergenic
1179569912 21:42272709-42272731 AAGGCAGGCACGGCCTCACCAGG - Intronic
1179606129 21:42516381-42516403 AAAGAACGCCCTGCCTCTTCAGG + Intronic
1179752610 21:43477644-43477666 ATGGCAGCCCCTGCCTCATGCGG + Intergenic
1182972187 22:34589295-34589317 GCAGCAGGCCCTGCCTCCTCAGG + Intergenic
1184671331 22:46013616-46013638 GACTCAGGCCCTGACTCACCAGG - Intergenic
953871864 3:46633923-46633945 AACGCAGGGCTTGCCTCAAGGGG + Intergenic
954782952 3:53074015-53074037 CTCGCAGGGCCTGCCTCACCGGG - Intronic
954968310 3:54630161-54630183 GAGCCAGGTCCTGCCTCATCAGG - Intronic
957001425 3:74890645-74890667 AACTCAAGCCCTGACTCAGCTGG - Intergenic
961936769 3:130592938-130592960 AACCCAGGCCCAGCCTCACAAGG + Intronic
967312723 3:188121334-188121356 ACCTCAGGCCATGCCCCATCTGG - Intergenic
968271951 3:197409801-197409823 AAAGAAGGCTCTGCCTCAGCAGG - Intergenic
968748341 4:2372631-2372653 GCCGCAGGCCCTCCCTCATCAGG - Intronic
969681571 4:8646076-8646098 AGCGCCGGCCCTGCCTCAAGTGG - Intergenic
971476613 4:27078525-27078547 GTCACAGGCCCTGCCTCACCGGG - Intergenic
982717765 4:158826952-158826974 AACGCAGTCTTTGTCTCATCAGG + Intronic
985691437 5:1314865-1314887 AACACAGCCCCTGCTTCGTCAGG + Intergenic
986374184 5:7113614-7113636 AAGACAGGCCCTTCCTCTTCTGG - Intergenic
986722849 5:10572358-10572380 AAAGTAGGCCCTGACTCAGCAGG - Intronic
988754415 5:34231651-34231673 ACCACAGGCCCAGCCTCATGTGG - Intergenic
991328358 5:65463444-65463466 AATTCAGGCCCTCCATCATCTGG - Intronic
991742624 5:69697344-69697366 ACCACAGGCCCAGCCTCATGTGG - Intergenic
991755070 5:69857860-69857882 ACCACAGGCCCAGCCTCATGTGG + Intergenic
991794197 5:70277082-70277104 ACCACAGGCCCAGCCTCATGTGG - Intergenic
991822014 5:70572657-70572679 ACCACAGGCCCAGCCTCATGTGG - Intergenic
991834397 5:70733008-70733030 ACCACAGGCCCAGCCTCATGTGG + Intergenic
991886575 5:71276624-71276646 ACCACAGGCCCAGCCTCATGTGG - Intergenic
1001342822 5:170862580-170862602 GACGCAGCCCCTGTCTCCTCTGG - Intronic
1002556520 5:180046061-180046083 ATGGCAGGCCCTGCCCCATGGGG + Intronic
1002608836 5:180400526-180400548 TAGGCATGCCCTGCCTCACCGGG + Intergenic
1005243403 6:23855722-23855744 TACCCAGGCCCTGCCCCGTCTGG + Intergenic
1005553030 6:26943361-26943383 ACCACAGGCCCAGCCTCATGTGG - Intergenic
1018143333 6:160861389-160861411 AGAGCAGGTCCTGCATCATCAGG - Intergenic
1018732282 6:166660543-166660565 AACACAGCTCCTGCCTCATAAGG + Intronic
1018813455 6:167314385-167314407 ACCGCACACCCTGCCTCACCGGG + Intronic
1019702915 7:2482732-2482754 AACCCTGGCCCTGCCTCTGCAGG - Intergenic
1021848848 7:24788291-24788313 ATCCCAGGCCCTGTCTCCTCGGG - Intergenic
1022423866 7:30248961-30248983 ACCACAGGCTCTGCCTCAGCTGG - Intergenic
1022788676 7:33664604-33664626 AATGCAGGTCCTGCCTCCCCAGG - Intergenic
1025818920 7:64945503-64945525 TACCCAGGCCCTGCCCCCTCTGG + Intergenic
1026847575 7:73706388-73706410 AAGGCAGGCTCTGCCTCCTCTGG - Intronic
1028199894 7:87949161-87949183 AACACAGGCCCTGGCTCTGCTGG - Intronic
1032410818 7:131692389-131692411 CACGGTGGCCCTGCCGCATCAGG - Intergenic
1032829739 7:135610628-135610650 AATGCAGATCCTGACTCATCAGG - Intronic
1035662453 8:1358473-1358495 AACGCAGCCCTTGCCTCACATGG - Intergenic
1037434826 8:18851444-18851466 AAAGCAGGCTCTGTCTCCTCAGG + Intronic
1041113259 8:54507495-54507517 AGAGCAGGCCCTGCCTCACTAGG - Intergenic
1046980349 8:120330213-120330235 CACGCATCCCCTGCCTTATCTGG + Intronic
1049159357 8:141087447-141087469 AACACAGGGCCTGCCTTTTCTGG + Intergenic
1049246946 8:141567861-141567883 AAGGCAGGCCCTGATTCCTCCGG - Intergenic
1050270808 9:3942696-3942718 AACACAGACTCTGCCTCAGCAGG + Intronic
1050345293 9:4679896-4679918 AACGCAGGCCCCTTCTCACCTGG - Exonic
1050587087 9:7124036-7124058 AAAGGAGGCCCAGCCTCATTGGG - Intergenic
1051194901 9:14553673-14553695 AACGCTGGATCTGCCACATCTGG - Intergenic
1051409611 9:16775978-16776000 AACGCAGCTGCTGCCTCAGCAGG + Intronic
1052865787 9:33463966-33463988 AAAGCAGGCCCAGCCTGACCTGG - Intronic
1060064043 9:120486942-120486964 ACAGCAGGCCCTTCCTTATCTGG - Intronic
1060826904 9:126692957-126692979 CCCACAGGCCCTACCTCATCTGG - Intronic
1061199556 9:129129168-129129190 AATGCAGGCCCTTCCCCAACTGG - Intronic
1062180252 9:135187562-135187584 CACCCAGACCCTGCCTCACCCGG - Intergenic
1062359775 9:136182242-136182264 GAAGCCGGCCCTGCCTCATCTGG + Intergenic
1062521932 9:136961547-136961569 CCCTCAGGCCCTGCCTGATCCGG + Intergenic
1062525668 9:136977201-136977223 AACACAGCCCCTGCCCTATCAGG + Intergenic
1185469642 X:374687-374709 CACGCAGGACCTTCCTGATCGGG - Intronic
1189350714 X:40273619-40273641 CAGGCAGGCCCTTCCTCCTCTGG - Intergenic
1189467583 X:41289011-41289033 AGCACAGGCCAGGCCTCATCTGG - Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic