ID: 1175094017

View in Genome Browser
Species Human (GRCh38)
Location 20:56527638-56527660
Sequence AGCCATGGCCTCCTGCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175094017_1175094025 14 Left 1175094017 20:56527638-56527660 CCATGAGGCAGGAGGCCATGGCT No data
Right 1175094025 20:56527675-56527697 AGAAGCAGGAGAGGGAGGCAGGG No data
1175094017_1175094020 0 Left 1175094017 20:56527638-56527660 CCATGAGGCAGGAGGCCATGGCT No data
Right 1175094020 20:56527661-56527683 TCTGCGGCTGCAGCAGAAGCAGG No data
1175094017_1175094021 5 Left 1175094017 20:56527638-56527660 CCATGAGGCAGGAGGCCATGGCT No data
Right 1175094021 20:56527666-56527688 GGCTGCAGCAGAAGCAGGAGAGG No data
1175094017_1175094023 9 Left 1175094017 20:56527638-56527660 CCATGAGGCAGGAGGCCATGGCT No data
Right 1175094023 20:56527670-56527692 GCAGCAGAAGCAGGAGAGGGAGG No data
1175094017_1175094024 13 Left 1175094017 20:56527638-56527660 CCATGAGGCAGGAGGCCATGGCT No data
Right 1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG No data
1175094017_1175094022 6 Left 1175094017 20:56527638-56527660 CCATGAGGCAGGAGGCCATGGCT No data
Right 1175094022 20:56527667-56527689 GCTGCAGCAGAAGCAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175094017 Original CRISPR AGCCATGGCCTCCTGCCTCA TGG (reversed) Intergenic
No off target data available for this crispr