ID: 1175094024

View in Genome Browser
Species Human (GRCh38)
Location 20:56527674-56527696
Sequence CAGAAGCAGGAGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175094017_1175094024 13 Left 1175094017 20:56527638-56527660 CCATGAGGCAGGAGGCCATGGCT No data
Right 1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG No data
1175094015_1175094024 19 Left 1175094015 20:56527632-56527654 CCAAGACCATGAGGCAGGAGGCC No data
Right 1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG No data
1175094019_1175094024 -2 Left 1175094019 20:56527653-56527675 CCATGGCTTCTGCGGCTGCAGCA No data
Right 1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175094024 Original CRISPR CAGAAGCAGGAGAGGGAGGC AGG Intergenic
No off target data available for this crispr