ID: 1175108332

View in Genome Browser
Species Human (GRCh38)
Location 20:56629638-56629660
Sequence GTCCAGTGGCCCCTGCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 431}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175108332_1175108343 17 Left 1175108332 20:56629638-56629660 CCGGGAGGCAGGGGCCACTGGAC 0: 1
1: 0
2: 1
3: 54
4: 431
Right 1175108343 20:56629678-56629700 GCATAGGAGCCCTGGCCTCTCGG 0: 1
1: 0
2: 1
3: 25
4: 201
1175108332_1175108338 -6 Left 1175108332 20:56629638-56629660 CCGGGAGGCAGGGGCCACTGGAC 0: 1
1: 0
2: 1
3: 54
4: 431
Right 1175108338 20:56629655-56629677 CTGGACCGAGGTCGGGGACGAGG 0: 1
1: 0
2: 0
3: 7
4: 127
1175108332_1175108348 26 Left 1175108332 20:56629638-56629660 CCGGGAGGCAGGGGCCACTGGAC 0: 1
1: 0
2: 1
3: 54
4: 431
Right 1175108348 20:56629687-56629709 CCCTGGCCTCTCGGTGGGACGGG 0: 1
1: 0
2: 0
3: 16
4: 472
1175108332_1175108339 -5 Left 1175108332 20:56629638-56629660 CCGGGAGGCAGGGGCCACTGGAC 0: 1
1: 0
2: 1
3: 54
4: 431
Right 1175108339 20:56629656-56629678 TGGACCGAGGTCGGGGACGAGGG 0: 1
1: 0
2: 0
3: 5
4: 79
1175108332_1175108342 9 Left 1175108332 20:56629638-56629660 CCGGGAGGCAGGGGCCACTGGAC 0: 1
1: 0
2: 1
3: 54
4: 431
Right 1175108342 20:56629670-56629692 GGACGAGGGCATAGGAGCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 185
1175108332_1175108345 21 Left 1175108332 20:56629638-56629660 CCGGGAGGCAGGGGCCACTGGAC 0: 1
1: 0
2: 1
3: 54
4: 431
Right 1175108345 20:56629682-56629704 AGGAGCCCTGGCCTCTCGGTGGG 0: 1
1: 0
2: 0
3: 25
4: 169
1175108332_1175108344 20 Left 1175108332 20:56629638-56629660 CCGGGAGGCAGGGGCCACTGGAC 0: 1
1: 0
2: 1
3: 54
4: 431
Right 1175108344 20:56629681-56629703 TAGGAGCCCTGGCCTCTCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 148
1175108332_1175108341 1 Left 1175108332 20:56629638-56629660 CCGGGAGGCAGGGGCCACTGGAC 0: 1
1: 0
2: 1
3: 54
4: 431
Right 1175108341 20:56629662-56629684 GAGGTCGGGGACGAGGGCATAGG 0: 1
1: 0
2: 1
3: 14
4: 211
1175108332_1175108346 25 Left 1175108332 20:56629638-56629660 CCGGGAGGCAGGGGCCACTGGAC 0: 1
1: 0
2: 1
3: 54
4: 431
Right 1175108346 20:56629686-56629708 GCCCTGGCCTCTCGGTGGGACGG 0: 1
1: 0
2: 1
3: 21
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175108332 Original CRISPR GTCCAGTGGCCCCTGCCTCC CGG (reversed) Intronic