ID: 1175108337

View in Genome Browser
Species Human (GRCh38)
Location 20:56629652-56629674
Sequence CGTCCCCGACCTCGGTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175108337_1175108346 11 Left 1175108337 20:56629652-56629674 CCACTGGACCGAGGTCGGGGACG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1175108346 20:56629686-56629708 GCCCTGGCCTCTCGGTGGGACGG 0: 1
1: 0
2: 1
3: 21
4: 235
1175108337_1175108345 7 Left 1175108337 20:56629652-56629674 CCACTGGACCGAGGTCGGGGACG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1175108345 20:56629682-56629704 AGGAGCCCTGGCCTCTCGGTGGG 0: 1
1: 0
2: 0
3: 25
4: 169
1175108337_1175108342 -5 Left 1175108337 20:56629652-56629674 CCACTGGACCGAGGTCGGGGACG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1175108342 20:56629670-56629692 GGACGAGGGCATAGGAGCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 185
1175108337_1175108348 12 Left 1175108337 20:56629652-56629674 CCACTGGACCGAGGTCGGGGACG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1175108348 20:56629687-56629709 CCCTGGCCTCTCGGTGGGACGGG 0: 1
1: 0
2: 0
3: 16
4: 472
1175108337_1175108343 3 Left 1175108337 20:56629652-56629674 CCACTGGACCGAGGTCGGGGACG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1175108343 20:56629678-56629700 GCATAGGAGCCCTGGCCTCTCGG 0: 1
1: 0
2: 1
3: 25
4: 201
1175108337_1175108351 26 Left 1175108337 20:56629652-56629674 CCACTGGACCGAGGTCGGGGACG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1175108351 20:56629701-56629723 TGGGACGGGATCCACTTCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 63
1175108337_1175108344 6 Left 1175108337 20:56629652-56629674 CCACTGGACCGAGGTCGGGGACG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1175108344 20:56629681-56629703 TAGGAGCCCTGGCCTCTCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175108337 Original CRISPR CGTCCCCGACCTCGGTCCAG TGG (reversed) Intronic