ID: 1175108340

View in Genome Browser
Species Human (GRCh38)
Location 20:56629660-56629682
Sequence TATGCCCTCGTCCCCGACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 54}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175108340_1175108343 -5 Left 1175108340 20:56629660-56629682 CCGAGGTCGGGGACGAGGGCATA 0: 1
1: 0
2: 1
3: 2
4: 54
Right 1175108343 20:56629678-56629700 GCATAGGAGCCCTGGCCTCTCGG 0: 1
1: 0
2: 1
3: 25
4: 201
1175108340_1175108345 -1 Left 1175108340 20:56629660-56629682 CCGAGGTCGGGGACGAGGGCATA 0: 1
1: 0
2: 1
3: 2
4: 54
Right 1175108345 20:56629682-56629704 AGGAGCCCTGGCCTCTCGGTGGG 0: 1
1: 0
2: 0
3: 25
4: 169
1175108340_1175108351 18 Left 1175108340 20:56629660-56629682 CCGAGGTCGGGGACGAGGGCATA 0: 1
1: 0
2: 1
3: 2
4: 54
Right 1175108351 20:56629701-56629723 TGGGACGGGATCCACTTCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 63
1175108340_1175108346 3 Left 1175108340 20:56629660-56629682 CCGAGGTCGGGGACGAGGGCATA 0: 1
1: 0
2: 1
3: 2
4: 54
Right 1175108346 20:56629686-56629708 GCCCTGGCCTCTCGGTGGGACGG 0: 1
1: 0
2: 1
3: 21
4: 235
1175108340_1175108344 -2 Left 1175108340 20:56629660-56629682 CCGAGGTCGGGGACGAGGGCATA 0: 1
1: 0
2: 1
3: 2
4: 54
Right 1175108344 20:56629681-56629703 TAGGAGCCCTGGCCTCTCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 148
1175108340_1175108348 4 Left 1175108340 20:56629660-56629682 CCGAGGTCGGGGACGAGGGCATA 0: 1
1: 0
2: 1
3: 2
4: 54
Right 1175108348 20:56629687-56629709 CCCTGGCCTCTCGGTGGGACGGG 0: 1
1: 0
2: 0
3: 16
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175108340 Original CRISPR TATGCCCTCGTCCCCGACCT CGG (reversed) Intronic