ID: 1175108344

View in Genome Browser
Species Human (GRCh38)
Location 20:56629681-56629703
Sequence TAGGAGCCCTGGCCTCTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175108332_1175108344 20 Left 1175108332 20:56629638-56629660 CCGGGAGGCAGGGGCCACTGGAC 0: 1
1: 0
2: 1
3: 54
4: 431
Right 1175108344 20:56629681-56629703 TAGGAGCCCTGGCCTCTCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 148
1175108337_1175108344 6 Left 1175108337 20:56629652-56629674 CCACTGGACCGAGGTCGGGGACG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1175108344 20:56629681-56629703 TAGGAGCCCTGGCCTCTCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 148
1175108340_1175108344 -2 Left 1175108340 20:56629660-56629682 CCGAGGTCGGGGACGAGGGCATA 0: 1
1: 0
2: 1
3: 2
4: 54
Right 1175108344 20:56629681-56629703 TAGGAGCCCTGGCCTCTCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175108344 Original CRISPR TAGGAGCCCTGGCCTCTCGG TGG Intronic
900940322 1:5794340-5794362 TGGGAGCCTTGGCCTCACGTGGG - Intergenic
902444309 1:16452220-16452242 TCGCAGCCCTGGCCTCTCAGGGG - Intronic
902892444 1:19454053-19454075 CAGGAGCCCTGGCCACTCTGGGG - Intronic
904253090 1:29238289-29238311 TAGGATCCCAGGCCTCAGGGTGG - Intronic
904339372 1:29824238-29824260 AAGGAGCCCTGGCCTCGAGTGGG + Intergenic
905312970 1:37063410-37063432 GAGGAGGCCTGACCTCCCGGTGG + Intergenic
906143640 1:43547696-43547718 TGGGGGCCCTGGCCTCTGAGGGG + Intronic
907050914 1:51329686-51329708 TAGGAGCCCTGACTGCTGGGAGG - Intronic
907664779 1:56425189-56425211 TAGGTTGCCTGGCCTCTCAGTGG - Intergenic
911183690 1:94883048-94883070 TCTGACCCCTGGCCTCTCTGTGG - Intronic
912561775 1:110556242-110556264 TGGGAGCCCTGAGCTCTCAGAGG + Intergenic
916179288 1:162070030-162070052 GGGGAGCCCTGGCCGCGCGGCGG - Exonic
917448445 1:175126623-175126645 TGGGAGCCCTGCCATCTCTGAGG + Intronic
920102851 1:203528796-203528818 TCTGAGCCCTGGGCTCACGGTGG - Intergenic
1062856707 10:783472-783494 GAGGAGCGCTGGCCGCTGGGTGG - Intergenic
1063574825 10:7252240-7252262 CAGAAGCCCTGCCCTCTCTGAGG + Intronic
1074228541 10:111511660-111511682 TAGCAGCCCTGGACTCTCAGAGG + Intergenic
1075575744 10:123576281-123576303 TAGGAGCCCTGCCCTCCCTTAGG - Intergenic
1077545219 11:3166215-3166237 GAGGAGCCCAGGGCTCTCTGCGG - Intronic
1084475187 11:69384922-69384944 TAGGTGGCCTGCCCTCTGGGAGG + Intergenic
1084730784 11:71072188-71072210 AAGGGGCCCTGGGCTCACGGGGG - Intronic
1084730847 11:71072392-71072414 TGTGAGCCCTGCCCTCTGGGAGG - Intronic
1085452129 11:76640720-76640742 TAGCAGCCCTGGCCTCCTGTGGG + Intergenic
1088034852 11:105298828-105298850 GAGGAGTCCTGGCCTTTGGGAGG + Intergenic
1088724897 11:112625469-112625491 TAGGAGGCAGGGCCTCTTGGAGG + Intergenic
1088884906 11:113998926-113998948 CAGGAGCCCTGGCCTGCAGGCGG + Intergenic
1090196117 11:124817935-124817957 CAGGAGGCTTGGCCTCTGGGTGG + Intergenic
1097053380 12:56236778-56236800 TAGGAGCCCTGGCCTCCCCTCGG - Intronic
1101600420 12:106204895-106204917 TAGGAGGCAGGGCCTCTGGGAGG + Intergenic
1103860517 12:124008904-124008926 AAGGACCCCTTGCCTCTTGGTGG + Intronic
1103901055 12:124303800-124303822 CAGGAGCCCGGGCCTGTGGGAGG + Intronic
1105696934 13:22898055-22898077 CAGGGACCCTGGCCTCTTGGGGG - Intergenic
1106246578 13:27954686-27954708 AAGGAGCCCGGGCCCCGCGGCGG + Intergenic
1107363697 13:39647235-39647257 TAGGAGGCTTGGCCTTTGGGAGG + Intergenic
1109335572 13:60990230-60990252 TAAGAGCCCTGGCCTCAAGGGGG - Intergenic
1109687694 13:65843409-65843431 TGGCATCCCTGCCCTCTCGGAGG + Intergenic
1113822855 13:113227448-113227470 TAGGAGGCAGGGCCTCTGGGAGG - Intronic
1113841288 13:113363165-113363187 TAGGAGGCCTGGGGTCGCGGAGG + Intronic
1113983564 13:114295995-114296017 TAGGCCCTCTGCCCTCTCGGAGG - Intronic
1123665663 15:22608148-22608170 TATGAGCCCTGTCCTCCCGCAGG - Intergenic
1124393242 15:29278514-29278536 TTGGAGCCCAGGCCTCACAGGGG - Intronic
1124631659 15:31341202-31341224 GAGGAGCCCTGGCCTCAGAGTGG + Intronic
1126194694 15:45918942-45918964 CTGGAGCCCTGGCCTCTGGCTGG - Intergenic
1129389909 15:75215295-75215317 TGGGAGCCCAGGCCTCACTGAGG - Intergenic
1129462958 15:75709123-75709145 TAGGAACCCTTGCCCCACGGAGG + Intronic
1129467187 15:75730813-75730835 CTGGAGCCCTGGCCTCCAGGAGG + Intergenic
1129720041 15:77872906-77872928 CTGGAGCCCTGGCCTCCAGGAGG - Intergenic
1131177939 15:90221498-90221520 CAGGATCCCTGCCCTCTGGGTGG - Intronic
1132086702 15:98914204-98914226 TAGGAGGCATGGCCTTTGGGAGG - Intronic
1132615567 16:839751-839773 TTGCAGCCCCGGCCACTCGGTGG - Intergenic
1132883222 16:2171403-2171425 CAGGACCCCAGGGCTCTCGGGGG + Intronic
1136933345 16:34437291-34437313 GAGGGGCCTGGGCCTCTCGGGGG - Intergenic
1136971227 16:34974523-34974545 GAGGGGCCTGGGCCTCTCGGGGG + Intergenic
1139924917 16:70480780-70480802 TAGGAGCCCGCTTCTCTCGGTGG + Exonic
1141348283 16:83268828-83268850 GAGCAGCTCTGGCCTCTCTGTGG - Intronic
1141626528 16:85264367-85264389 GGGGAGCCCTGGCCTCACGCTGG + Intergenic
1143329288 17:6121709-6121731 TAGGGGCCCTGTTCTCTCTGGGG + Exonic
1143548481 17:7614509-7614531 TGGGCGGCCTGGCCTCTGGGGGG - Exonic
1143702055 17:8667786-8667808 AAGGAGCCTTGGACTCTTGGAGG - Intergenic
1147400619 17:40178186-40178208 CCGGGGCCCGGGCCTCTCGGGGG + Intronic
1151208623 17:72527267-72527289 TAGGAGATGTGGCCTCTGGGAGG - Intergenic
1151425340 17:74027624-74027646 TTGGAGGCCTGGACTCTAGGAGG + Intergenic
1152625519 17:81386463-81386485 AAGGAGCCCTGGCCTGCGGGAGG - Intergenic
1160446377 18:78930384-78930406 TAGGAGCCCTGACTCCTCTGTGG - Intergenic
1160686339 19:438661-438683 TAGGACTCCTGGCCCCTCTGGGG + Intronic
1160822607 19:1065488-1065510 TAGGAGCCCTGGACTCAGGCTGG + Exonic
1161318899 19:3632072-3632094 TGGGAGCGCTGCCCTCTTGGAGG + Exonic
1162555702 19:11384221-11384243 CAGGAGCCCTGGGCTCCCCGTGG - Exonic
1162840138 19:13350188-13350210 TAGGAGGCCAGGCCTCTCAGAGG - Intronic
1163521807 19:17795940-17795962 TAGGAGCTGTGGCCACTCAGTGG + Intronic
1164156934 19:22602766-22602788 TCTGAGCCCTGTCCTCTCGCAGG + Intergenic
1165259318 19:34598726-34598748 TCCGTGCCCTGGCCTCTCTGTGG + Intronic
1165814965 19:38636270-38636292 TAGGAGCCCAGCCCTGCCGGGGG + Intronic
1166966645 19:46533238-46533260 CAGGAGGCCTGGGCTCTGGGAGG - Intronic
1167383071 19:49149668-49149690 CGGGAGCCCTGGGCTCTCCGGGG + Exonic
1167595802 19:50427557-50427579 CAGGTGCCCTGGCCTCTCCCGGG + Intronic
1168278724 19:55292112-55292134 TTGAAACCCTGGCCTCTAGGGGG + Intronic
1168280504 19:55302950-55302972 GAGGAACCCTGGCCTCTCATGGG + Intronic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
925036197 2:688211-688233 CAGGAGCCCTGCCCTCATGGTGG - Intergenic
926205932 2:10834431-10834453 ACGGAGGCCTGGCCTCTCTGTGG + Intronic
927912746 2:26912927-26912949 GAGTAGCCCTGGCCTGACGGAGG - Intronic
930194321 2:48494147-48494169 GAGGAGCCCTGGAGTCTGGGAGG + Intronic
930999160 2:57760225-57760247 TCAGAGCCCTGGGCTCTCAGAGG - Intergenic
932619046 2:73255199-73255221 GAGGAGGCTTGGCCTCACGGTGG + Exonic
933907152 2:86906205-86906227 TGGTAGCCCTGGCCACTCTGAGG + Intergenic
933908398 2:86915867-86915889 TGGTAGCCCTGGCCACTCTGAGG + Intronic
934024325 2:87987513-87987535 TGGTAGCCCTGGCCACTCTGAGG - Intergenic
935173376 2:100628084-100628106 TGGGAGCCTTGGCCTCTCAGGGG - Intergenic
936364965 2:111845208-111845230 TGGTAGCCCTGGCCACTCTGAGG - Intronic
938223017 2:129587815-129587837 GAGGTGCACTGGCCTCCCGGCGG + Intergenic
939172909 2:138716287-138716309 TAGGAGACCGGGCCTCGGGGAGG + Intronic
947327386 2:228992936-228992958 CAGGAGCCCTGCCCTCCCTGGGG - Intronic
947665756 2:231904433-231904455 TAGGAGCCCTGTCTTCTGGGGGG + Intergenic
948802315 2:240438470-240438492 CAGGAGCCCTGGACCCTCTGTGG + Intronic
1170890926 20:20374740-20374762 TAGGATCACTGGGCTCTTGGGGG - Intergenic
1172771576 20:37385369-37385391 GAGGAGCCCTGGCCTGTAGTAGG - Intronic
1173025314 20:39301946-39301968 AGGGAGCCCTGGCCTCCTGGTGG + Intergenic
1173413924 20:42839045-42839067 ATTGAGCCCTGGCCTCTAGGAGG - Intronic
1173998422 20:47357311-47357333 GAGCAGCCCTGGCTTCTCAGAGG + Intergenic
1174214232 20:48903889-48903911 TAGGACCCCTGACCTCCTGGGGG - Intergenic
1175108344 20:56629681-56629703 TAGGAGCCCTGGCCTCTCGGTGG + Intronic
1175735738 20:61385839-61385861 CAGGAGGCCTGGGCACTCGGGGG - Intronic
1175952817 20:62592469-62592491 AGGCAGCCCTGGCCTCTAGGAGG + Intergenic
1176184642 20:63771599-63771621 CCGGGGGCCTGGCCTCTCGGGGG - Intronic
1179799588 21:43804709-43804731 TCCAAGCCCTGGCCTCTCGCTGG - Exonic
1179807989 21:43852179-43852201 TAGGTGCCCAGGCCCCTCCGTGG + Intergenic
1180049266 21:45323962-45323984 CAGGAACCCTGCCCTGTCGGGGG - Intergenic
1183263994 22:36814617-36814639 AAGGACCCCTGGACTCTCAGAGG + Intronic
1184571983 22:45331010-45331032 TAGGAGCCCTGGCCATTTGGTGG + Intronic
1185119082 22:48955049-48955071 AGGGAGCCCTGGCCCCCCGGAGG - Intergenic
950184433 3:10936533-10936555 CTGGAGCCCAGGCCCCTCGGTGG - Intronic
950400381 3:12765345-12765367 TAGGAGCCATGGGCTGTCGATGG + Intronic
950491319 3:13306909-13306931 CAGGACCTCTGGCCTCTCTGGGG + Intergenic
954105306 3:48406644-48406666 TGGGAGCCCTGGTCTTTCAGTGG + Intronic
954686909 3:52376034-52376056 GAGGAGCCCTGGGCTCTGGTTGG + Intronic
964824276 3:160808497-160808519 GAGGAGCCCTGGCCTATAGCTGG + Intronic
965610583 3:170539368-170539390 AAGTGGCCCTGGCCTCTCTGTGG + Intronic
966672103 3:182538764-182538786 TTGGAGCCATGGCCTTTTGGGGG - Intergenic
968938932 4:3628015-3628037 CAGGAGCTCTGGCCTCTCACAGG - Intergenic
981344343 4:143658220-143658242 TAGGAGACGTGGCCTTTGGGAGG + Intronic
981903879 4:149896946-149896968 TAGGAGGCGGGGCCTCTGGGTGG + Intergenic
983984515 4:174041947-174041969 AGGGAGCCCTGGCCTCTCGAGGG + Intergenic
984296550 4:177861647-177861669 CAGGATCCCTGTGCTCTCGGGGG + Intronic
985038780 4:185867826-185867848 TAGGTGCCCCAGCCTCTCTGGGG - Intronic
985575680 5:672444-672466 TGGGAGCCCTGGCCTCCCCCAGG - Intronic
994027399 5:95100683-95100705 TAGGTGCTGTGGCCTCTCAGGGG - Intronic
995362142 5:111309417-111309439 AAGGAGCCCTGGCCACTCTTGGG + Intronic
1001601847 5:172934193-172934215 GAGGAGCCCAGGCCACTCCGGGG - Intronic
1003382927 6:5641187-5641209 TTGGTGCCCTTGCCTCTCAGTGG - Intronic
1003459904 6:6320081-6320103 CAGGAGCCCTCGCTTCTGGGCGG + Intronic
1007228400 6:40330616-40330638 TAGCAGCCCTGGCATCCCTGGGG + Intergenic
1013394640 6:109722948-109722970 AAGGAGCCCTGCCTTCTTGGCGG + Intronic
1016793580 6:148093060-148093082 TAGGAGCCAGGGCCTTTTGGAGG - Intergenic
1017723182 6:157258643-157258665 TAGGAGCCCTGGGCTCACCTTGG + Intergenic
1018391686 6:163346018-163346040 CAGAAGCCCTGGCCTCGCTGGGG + Intergenic
1019183937 6:170209948-170209970 CAGGACCCCTGGCCTGTTGGTGG - Intergenic
1019429301 7:991308-991330 GAGGAGCCCTGTCATCTCGCTGG - Intergenic
1019594406 7:1851814-1851836 TAGGAGGCCTGGCCTTTGGCAGG - Intronic
1019629037 7:2036717-2036739 CAGGAGCCCTGGCCTTGGGGAGG - Intronic
1020110701 7:5446375-5446397 GAGGAGCCTCGGCCTGTCGGGGG - Intronic
1022387462 7:29915197-29915219 TAGGAGCACTGGCTACTTGGAGG - Exonic
1023320601 7:38993811-38993833 TCGGAGCACTGGCCTCTTGCTGG + Intronic
1024244287 7:47457498-47457520 TAGGAGGAGTGGCCTCTTGGAGG - Intronic
1024647516 7:51382649-51382671 GAGGAGCCCTGGGCCCTCAGGGG + Intergenic
1032261172 7:130338115-130338137 TAGGAGCTCTGGGCTGACGGAGG + Intergenic
1037504150 8:19514173-19514195 TGGGACCCCTGTCCTCTCGCTGG - Intronic
1039035853 8:33358635-33358657 TAGGAGGTGTGGCCTCTAGGAGG + Intergenic
1039871296 8:41547672-41547694 CAGGTGCCCTGGCCTCACTGGGG - Intergenic
1042859220 8:73295772-73295794 AAGGTGCCCTGTCCTCGCGGAGG + Intronic
1049310293 8:141930588-141930610 AAGGGGCCCTGGCATCTCGTTGG + Intergenic
1049665312 8:143840380-143840402 TAGGAGCCCTTGGCTCCTGGGGG - Intronic
1049759559 8:144325958-144325980 GAGGAGCCCAGGCCTGTCCGAGG - Intronic
1053023045 9:34708958-34708980 TAGGAACCTTGGCATCTCGGTGG + Intergenic
1054451811 9:65407305-65407327 CAGGAGCTCTGGCCTCTCACAGG + Intergenic
1055828274 9:80352791-80352813 TAGGAGGCTGGGCCTCTGGGAGG + Intergenic
1056986024 9:91364335-91364357 CAGGAGCCCTGCCCTCCCCGAGG + Intergenic
1060416132 9:123432051-123432073 CAGGAGCCCTGGCCTCACCGTGG + Intronic
1061960093 9:133983479-133983501 TCGGGGCCCTGGCCTCAGGGCGG - Intronic
1190445000 X:50515178-50515200 CAGGAGCCCTGACCTCCTGGTGG - Intergenic
1200162906 X:154018464-154018486 TAGGGTCCCTGGCCCCTTGGTGG - Intronic