ID: 1175108344

View in Genome Browser
Species Human (GRCh38)
Location 20:56629681-56629703
Sequence TAGGAGCCCTGGCCTCTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175108340_1175108344 -2 Left 1175108340 20:56629660-56629682 CCGAGGTCGGGGACGAGGGCATA 0: 1
1: 0
2: 1
3: 2
4: 54
Right 1175108344 20:56629681-56629703 TAGGAGCCCTGGCCTCTCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 148
1175108337_1175108344 6 Left 1175108337 20:56629652-56629674 CCACTGGACCGAGGTCGGGGACG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1175108344 20:56629681-56629703 TAGGAGCCCTGGCCTCTCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 148
1175108332_1175108344 20 Left 1175108332 20:56629638-56629660 CCGGGAGGCAGGGGCCACTGGAC 0: 1
1: 0
2: 1
3: 54
4: 431
Right 1175108344 20:56629681-56629703 TAGGAGCCCTGGCCTCTCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175108344 Original CRISPR TAGGAGCCCTGGCCTCTCGG TGG Intronic