ID: 1175111895

View in Genome Browser
Species Human (GRCh38)
Location 20:56654325-56654347
Sequence TAAGTTTCCAAGGGCGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175111895_1175111902 5 Left 1175111895 20:56654325-56654347 CCCTTGGCGCCCTTGGAAACTTA No data
Right 1175111902 20:56654353-56654375 GTCTGGCATTTTCTATCAGTTGG No data
1175111895_1175111903 6 Left 1175111895 20:56654325-56654347 CCCTTGGCGCCCTTGGAAACTTA No data
Right 1175111903 20:56654354-56654376 TCTGGCATTTTCTATCAGTTGGG No data
1175111895_1175111905 27 Left 1175111895 20:56654325-56654347 CCCTTGGCGCCCTTGGAAACTTA No data
Right 1175111905 20:56654375-56654397 GGTCTGCGAGGACCACCTGCTGG No data
1175111895_1175111904 15 Left 1175111895 20:56654325-56654347 CCCTTGGCGCCCTTGGAAACTTA No data
Right 1175111904 20:56654363-56654385 TTCTATCAGTTGGGTCTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175111895 Original CRISPR TAAGTTTCCAAGGGCGCCAA GGG (reversed) Intergenic