ID: 1175111896

View in Genome Browser
Species Human (GRCh38)
Location 20:56654326-56654348
Sequence CTAAGTTTCCAAGGGCGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175111896_1175111904 14 Left 1175111896 20:56654326-56654348 CCTTGGCGCCCTTGGAAACTTAG No data
Right 1175111904 20:56654363-56654385 TTCTATCAGTTGGGTCTGCGAGG No data
1175111896_1175111905 26 Left 1175111896 20:56654326-56654348 CCTTGGCGCCCTTGGAAACTTAG No data
Right 1175111905 20:56654375-56654397 GGTCTGCGAGGACCACCTGCTGG No data
1175111896_1175111902 4 Left 1175111896 20:56654326-56654348 CCTTGGCGCCCTTGGAAACTTAG No data
Right 1175111902 20:56654353-56654375 GTCTGGCATTTTCTATCAGTTGG No data
1175111896_1175111903 5 Left 1175111896 20:56654326-56654348 CCTTGGCGCCCTTGGAAACTTAG No data
Right 1175111903 20:56654354-56654376 TCTGGCATTTTCTATCAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175111896 Original CRISPR CTAAGTTTCCAAGGGCGCCA AGG (reversed) Intergenic