ID: 1175111899

View in Genome Browser
Species Human (GRCh38)
Location 20:56654334-56654356
Sequence AGACCTACCTAAGTTTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175111899_1175111906 25 Left 1175111899 20:56654334-56654356 CCCTTGGAAACTTAGGTAGGTCT No data
Right 1175111906 20:56654382-56654404 GAGGACCACCTGCTGGTCCTTGG No data
1175111899_1175111905 18 Left 1175111899 20:56654334-56654356 CCCTTGGAAACTTAGGTAGGTCT No data
Right 1175111905 20:56654375-56654397 GGTCTGCGAGGACCACCTGCTGG No data
1175111899_1175111907 28 Left 1175111899 20:56654334-56654356 CCCTTGGAAACTTAGGTAGGTCT No data
Right 1175111907 20:56654385-56654407 GACCACCTGCTGGTCCTTGGCGG No data
1175111899_1175111903 -3 Left 1175111899 20:56654334-56654356 CCCTTGGAAACTTAGGTAGGTCT No data
Right 1175111903 20:56654354-56654376 TCTGGCATTTTCTATCAGTTGGG No data
1175111899_1175111904 6 Left 1175111899 20:56654334-56654356 CCCTTGGAAACTTAGGTAGGTCT No data
Right 1175111904 20:56654363-56654385 TTCTATCAGTTGGGTCTGCGAGG No data
1175111899_1175111902 -4 Left 1175111899 20:56654334-56654356 CCCTTGGAAACTTAGGTAGGTCT No data
Right 1175111902 20:56654353-56654375 GTCTGGCATTTTCTATCAGTTGG No data
1175111899_1175111910 30 Left 1175111899 20:56654334-56654356 CCCTTGGAAACTTAGGTAGGTCT No data
Right 1175111910 20:56654387-56654409 CCACCTGCTGGTCCTTGGCGGGG No data
1175111899_1175111908 29 Left 1175111899 20:56654334-56654356 CCCTTGGAAACTTAGGTAGGTCT No data
Right 1175111908 20:56654386-56654408 ACCACCTGCTGGTCCTTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175111899 Original CRISPR AGACCTACCTAAGTTTCCAA GGG (reversed) Intergenic
No off target data available for this crispr