ID: 1175111900

View in Genome Browser
Species Human (GRCh38)
Location 20:56654335-56654357
Sequence CAGACCTACCTAAGTTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175111900_1175111908 28 Left 1175111900 20:56654335-56654357 CCTTGGAAACTTAGGTAGGTCTG No data
Right 1175111908 20:56654386-56654408 ACCACCTGCTGGTCCTTGGCGGG No data
1175111900_1175111903 -4 Left 1175111900 20:56654335-56654357 CCTTGGAAACTTAGGTAGGTCTG No data
Right 1175111903 20:56654354-56654376 TCTGGCATTTTCTATCAGTTGGG No data
1175111900_1175111906 24 Left 1175111900 20:56654335-56654357 CCTTGGAAACTTAGGTAGGTCTG No data
Right 1175111906 20:56654382-56654404 GAGGACCACCTGCTGGTCCTTGG No data
1175111900_1175111902 -5 Left 1175111900 20:56654335-56654357 CCTTGGAAACTTAGGTAGGTCTG No data
Right 1175111902 20:56654353-56654375 GTCTGGCATTTTCTATCAGTTGG No data
1175111900_1175111910 29 Left 1175111900 20:56654335-56654357 CCTTGGAAACTTAGGTAGGTCTG No data
Right 1175111910 20:56654387-56654409 CCACCTGCTGGTCCTTGGCGGGG No data
1175111900_1175111904 5 Left 1175111900 20:56654335-56654357 CCTTGGAAACTTAGGTAGGTCTG No data
Right 1175111904 20:56654363-56654385 TTCTATCAGTTGGGTCTGCGAGG No data
1175111900_1175111907 27 Left 1175111900 20:56654335-56654357 CCTTGGAAACTTAGGTAGGTCTG No data
Right 1175111907 20:56654385-56654407 GACCACCTGCTGGTCCTTGGCGG No data
1175111900_1175111905 17 Left 1175111900 20:56654335-56654357 CCTTGGAAACTTAGGTAGGTCTG No data
Right 1175111905 20:56654375-56654397 GGTCTGCGAGGACCACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175111900 Original CRISPR CAGACCTACCTAAGTTTCCA AGG (reversed) Intergenic