ID: 1175111902

View in Genome Browser
Species Human (GRCh38)
Location 20:56654353-56654375
Sequence GTCTGGCATTTTCTATCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175111900_1175111902 -5 Left 1175111900 20:56654335-56654357 CCTTGGAAACTTAGGTAGGTCTG No data
Right 1175111902 20:56654353-56654375 GTCTGGCATTTTCTATCAGTTGG No data
1175111896_1175111902 4 Left 1175111896 20:56654326-56654348 CCTTGGCGCCCTTGGAAACTTAG No data
Right 1175111902 20:56654353-56654375 GTCTGGCATTTTCTATCAGTTGG No data
1175111895_1175111902 5 Left 1175111895 20:56654325-56654347 CCCTTGGCGCCCTTGGAAACTTA No data
Right 1175111902 20:56654353-56654375 GTCTGGCATTTTCTATCAGTTGG No data
1175111899_1175111902 -4 Left 1175111899 20:56654334-56654356 CCCTTGGAAACTTAGGTAGGTCT No data
Right 1175111902 20:56654353-56654375 GTCTGGCATTTTCTATCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175111902 Original CRISPR GTCTGGCATTTTCTATCAGT TGG Intergenic
No off target data available for this crispr