ID: 1175111915

View in Genome Browser
Species Human (GRCh38)
Location 20:56654418-56654440
Sequence AGTGAGATGGAGAAGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175111909_1175111915 8 Left 1175111909 20:56654387-56654409 CCACCTGCTGGTCCTTGGCGGGG No data
Right 1175111915 20:56654418-56654440 AGTGAGATGGAGAAGGTGAAAGG No data
1175111911_1175111915 5 Left 1175111911 20:56654390-56654412 CCTGCTGGTCCTTGGCGGGGCTC No data
Right 1175111915 20:56654418-56654440 AGTGAGATGGAGAAGGTGAAAGG No data
1175111912_1175111915 -4 Left 1175111912 20:56654399-56654421 CCTTGGCGGGGCTCATGAGAGTG No data
Right 1175111915 20:56654418-56654440 AGTGAGATGGAGAAGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175111915 Original CRISPR AGTGAGATGGAGAAGGTGAA AGG Intergenic
No off target data available for this crispr