ID: 1175112441

View in Genome Browser
Species Human (GRCh38)
Location 20:56658124-56658146
Sequence ACTGAAGGAACATAAATTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175112441_1175112454 30 Left 1175112441 20:56658124-56658146 CCGCCAATTTATGTTCCTTCAGT No data
Right 1175112454 20:56658177-56658199 TGCCTTGGAGGAGGATATGGTGG No data
1175112441_1175112449 15 Left 1175112441 20:56658124-56658146 CCGCCAATTTATGTTCCTTCAGT No data
Right 1175112449 20:56658162-56658184 GCCTCTTTGGTCAAATGCCTTGG No data
1175112441_1175112452 21 Left 1175112441 20:56658124-56658146 CCGCCAATTTATGTTCCTTCAGT No data
Right 1175112452 20:56658168-56658190 TTGGTCAAATGCCTTGGAGGAGG No data
1175112441_1175112447 2 Left 1175112441 20:56658124-56658146 CCGCCAATTTATGTTCCTTCAGT No data
Right 1175112447 20:56658149-56658171 GGATGGCTGGCCAGCCTCTTTGG No data
1175112441_1175112453 27 Left 1175112441 20:56658124-56658146 CCGCCAATTTATGTTCCTTCAGT No data
Right 1175112453 20:56658174-56658196 AAATGCCTTGGAGGAGGATATGG No data
1175112441_1175112451 18 Left 1175112441 20:56658124-56658146 CCGCCAATTTATGTTCCTTCAGT No data
Right 1175112451 20:56658165-56658187 TCTTTGGTCAAATGCCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175112441 Original CRISPR ACTGAAGGAACATAAATTGG CGG (reversed) Intergenic