ID: 1175112446

View in Genome Browser
Species Human (GRCh38)
Location 20:56658139-56658161
Sequence TGGCCAGCCATCCTGACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175112446_1175112457 17 Left 1175112446 20:56658139-56658161 CCTTCAGTCAGGATGGCTGGCCA No data
Right 1175112457 20:56658179-56658201 CCTTGGAGGAGGATATGGTGGGG No data
1175112446_1175112452 6 Left 1175112446 20:56658139-56658161 CCTTCAGTCAGGATGGCTGGCCA No data
Right 1175112452 20:56658168-56658190 TTGGTCAAATGCCTTGGAGGAGG No data
1175112446_1175112449 0 Left 1175112446 20:56658139-56658161 CCTTCAGTCAGGATGGCTGGCCA No data
Right 1175112449 20:56658162-56658184 GCCTCTTTGGTCAAATGCCTTGG No data
1175112446_1175112455 16 Left 1175112446 20:56658139-56658161 CCTTCAGTCAGGATGGCTGGCCA No data
Right 1175112455 20:56658178-56658200 GCCTTGGAGGAGGATATGGTGGG No data
1175112446_1175112458 24 Left 1175112446 20:56658139-56658161 CCTTCAGTCAGGATGGCTGGCCA No data
Right 1175112458 20:56658186-56658208 GGAGGATATGGTGGGGCCGATGG No data
1175112446_1175112453 12 Left 1175112446 20:56658139-56658161 CCTTCAGTCAGGATGGCTGGCCA No data
Right 1175112453 20:56658174-56658196 AAATGCCTTGGAGGAGGATATGG No data
1175112446_1175112454 15 Left 1175112446 20:56658139-56658161 CCTTCAGTCAGGATGGCTGGCCA No data
Right 1175112454 20:56658177-56658199 TGCCTTGGAGGAGGATATGGTGG No data
1175112446_1175112451 3 Left 1175112446 20:56658139-56658161 CCTTCAGTCAGGATGGCTGGCCA No data
Right 1175112451 20:56658165-56658187 TCTTTGGTCAAATGCCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175112446 Original CRISPR TGGCCAGCCATCCTGACTGA AGG (reversed) Intergenic