ID: 1175112448

View in Genome Browser
Species Human (GRCh38)
Location 20:56658159-56658181
Sequence AGGCATTTGACCAAAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175112448_1175112457 -3 Left 1175112448 20:56658159-56658181 CCAGCCTCTTTGGTCAAATGCCT No data
Right 1175112457 20:56658179-56658201 CCTTGGAGGAGGATATGGTGGGG No data
1175112448_1175112458 4 Left 1175112448 20:56658159-56658181 CCAGCCTCTTTGGTCAAATGCCT No data
Right 1175112458 20:56658186-56658208 GGAGGATATGGTGGGGCCGATGG No data
1175112448_1175112460 26 Left 1175112448 20:56658159-56658181 CCAGCCTCTTTGGTCAAATGCCT No data
Right 1175112460 20:56658208-56658230 GATTTCTTCCAAAATGAAGATGG No data
1175112448_1175112454 -5 Left 1175112448 20:56658159-56658181 CCAGCCTCTTTGGTCAAATGCCT No data
Right 1175112454 20:56658177-56658199 TGCCTTGGAGGAGGATATGGTGG No data
1175112448_1175112453 -8 Left 1175112448 20:56658159-56658181 CCAGCCTCTTTGGTCAAATGCCT No data
Right 1175112453 20:56658174-56658196 AAATGCCTTGGAGGAGGATATGG No data
1175112448_1175112455 -4 Left 1175112448 20:56658159-56658181 CCAGCCTCTTTGGTCAAATGCCT No data
Right 1175112455 20:56658178-56658200 GCCTTGGAGGAGGATATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175112448 Original CRISPR AGGCATTTGACCAAAGAGGC TGG (reversed) Intergenic