ID: 1175112450

View in Genome Browser
Species Human (GRCh38)
Location 20:56658163-56658185
Sequence TCCAAGGCATTTGACCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175112450_1175112455 -8 Left 1175112450 20:56658163-56658185 CCTCTTTGGTCAAATGCCTTGGA No data
Right 1175112455 20:56658178-56658200 GCCTTGGAGGAGGATATGGTGGG No data
1175112450_1175112454 -9 Left 1175112450 20:56658163-56658185 CCTCTTTGGTCAAATGCCTTGGA No data
Right 1175112454 20:56658177-56658199 TGCCTTGGAGGAGGATATGGTGG No data
1175112450_1175112460 22 Left 1175112450 20:56658163-56658185 CCTCTTTGGTCAAATGCCTTGGA No data
Right 1175112460 20:56658208-56658230 GATTTCTTCCAAAATGAAGATGG No data
1175112450_1175112458 0 Left 1175112450 20:56658163-56658185 CCTCTTTGGTCAAATGCCTTGGA No data
Right 1175112458 20:56658186-56658208 GGAGGATATGGTGGGGCCGATGG No data
1175112450_1175112457 -7 Left 1175112450 20:56658163-56658185 CCTCTTTGGTCAAATGCCTTGGA No data
Right 1175112457 20:56658179-56658201 CCTTGGAGGAGGATATGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175112450 Original CRISPR TCCAAGGCATTTGACCAAAG AGG (reversed) Intergenic
No off target data available for this crispr