ID: 1175112453

View in Genome Browser
Species Human (GRCh38)
Location 20:56658174-56658196
Sequence AAATGCCTTGGAGGAGGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175112441_1175112453 27 Left 1175112441 20:56658124-56658146 CCGCCAATTTATGTTCCTTCAGT No data
Right 1175112453 20:56658174-56658196 AAATGCCTTGGAGGAGGATATGG No data
1175112442_1175112453 24 Left 1175112442 20:56658127-56658149 CCAATTTATGTTCCTTCAGTCAG No data
Right 1175112453 20:56658174-56658196 AAATGCCTTGGAGGAGGATATGG No data
1175112446_1175112453 12 Left 1175112446 20:56658139-56658161 CCTTCAGTCAGGATGGCTGGCCA No data
Right 1175112453 20:56658174-56658196 AAATGCCTTGGAGGAGGATATGG No data
1175112448_1175112453 -8 Left 1175112448 20:56658159-56658181 CCAGCCTCTTTGGTCAAATGCCT No data
Right 1175112453 20:56658174-56658196 AAATGCCTTGGAGGAGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175112453 Original CRISPR AAATGCCTTGGAGGAGGATA TGG Intergenic