ID: 1175112456

View in Genome Browser
Species Human (GRCh38)
Location 20:56658179-56658201
Sequence CCCCACCATATCCTCCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175112456_1175112460 6 Left 1175112456 20:56658179-56658201 CCTTGGAGGAGGATATGGTGGGG No data
Right 1175112460 20:56658208-56658230 GATTTCTTCCAAAATGAAGATGG No data
1175112456_1175112462 15 Left 1175112456 20:56658179-56658201 CCTTGGAGGAGGATATGGTGGGG No data
Right 1175112462 20:56658217-56658239 CAAAATGAAGATGGTGATAATGG No data
1175112456_1175112463 23 Left 1175112456 20:56658179-56658201 CCTTGGAGGAGGATATGGTGGGG No data
Right 1175112463 20:56658225-56658247 AGATGGTGATAATGGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175112456 Original CRISPR CCCCACCATATCCTCCTCCA AGG (reversed) Intergenic
No off target data available for this crispr