ID: 1175112457

View in Genome Browser
Species Human (GRCh38)
Location 20:56658179-56658201
Sequence CCTTGGAGGAGGATATGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175112442_1175112457 29 Left 1175112442 20:56658127-56658149 CCAATTTATGTTCCTTCAGTCAG No data
Right 1175112457 20:56658179-56658201 CCTTGGAGGAGGATATGGTGGGG No data
1175112446_1175112457 17 Left 1175112446 20:56658139-56658161 CCTTCAGTCAGGATGGCTGGCCA No data
Right 1175112457 20:56658179-56658201 CCTTGGAGGAGGATATGGTGGGG No data
1175112450_1175112457 -7 Left 1175112450 20:56658163-56658185 CCTCTTTGGTCAAATGCCTTGGA No data
Right 1175112457 20:56658179-56658201 CCTTGGAGGAGGATATGGTGGGG No data
1175112448_1175112457 -3 Left 1175112448 20:56658159-56658181 CCAGCCTCTTTGGTCAAATGCCT No data
Right 1175112457 20:56658179-56658201 CCTTGGAGGAGGATATGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175112457 Original CRISPR CCTTGGAGGAGGATATGGTG GGG Intergenic