ID: 1175112458

View in Genome Browser
Species Human (GRCh38)
Location 20:56658186-56658208
Sequence GGAGGATATGGTGGGGCCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175112446_1175112458 24 Left 1175112446 20:56658139-56658161 CCTTCAGTCAGGATGGCTGGCCA No data
Right 1175112458 20:56658186-56658208 GGAGGATATGGTGGGGCCGATGG No data
1175112450_1175112458 0 Left 1175112450 20:56658163-56658185 CCTCTTTGGTCAAATGCCTTGGA No data
Right 1175112458 20:56658186-56658208 GGAGGATATGGTGGGGCCGATGG No data
1175112448_1175112458 4 Left 1175112448 20:56658159-56658181 CCAGCCTCTTTGGTCAAATGCCT No data
Right 1175112458 20:56658186-56658208 GGAGGATATGGTGGGGCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175112458 Original CRISPR GGAGGATATGGTGGGGCCGA TGG Intergenic