ID: 1175112460

View in Genome Browser
Species Human (GRCh38)
Location 20:56658208-56658230
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175112456_1175112460 6 Left 1175112456 20:56658179-56658201 CCTTGGAGGAGGATATGGTGGGG No data
Right 1175112460 20:56658208-56658230 GATTTCTTCCAAAATGAAGATGG No data
1175112450_1175112460 22 Left 1175112450 20:56658163-56658185 CCTCTTTGGTCAAATGCCTTGGA No data
Right 1175112460 20:56658208-56658230 GATTTCTTCCAAAATGAAGATGG No data
1175112448_1175112460 26 Left 1175112448 20:56658159-56658181 CCAGCCTCTTTGGTCAAATGCCT No data
Right 1175112460 20:56658208-56658230 GATTTCTTCCAAAATGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175112460 Original CRISPR GATTTCTTCCAAAATGAAGA TGG Intergenic