ID: 1175112463

View in Genome Browser
Species Human (GRCh38)
Location 20:56658225-56658247
Sequence AGATGGTGATAATGGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175112456_1175112463 23 Left 1175112456 20:56658179-56658201 CCTTGGAGGAGGATATGGTGGGG No data
Right 1175112463 20:56658225-56658247 AGATGGTGATAATGGCAGCAAGG No data
1175112459_1175112463 0 Left 1175112459 20:56658202-56658224 CCGATGGATTTCTTCCAAAATGA No data
Right 1175112463 20:56658225-56658247 AGATGGTGATAATGGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175112463 Original CRISPR AGATGGTGATAATGGCAGCA AGG Intergenic
No off target data available for this crispr