ID: 1175113068

View in Genome Browser
Species Human (GRCh38)
Location 20:56662677-56662699
Sequence GAAACATCACAAACCCTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175113068_1175113076 14 Left 1175113068 20:56662677-56662699 CCTTACAGGGTTTGTGATGTTTC No data
Right 1175113076 20:56662714-56662736 TATAAAGGAGCTGCTGGGCTGGG No data
1175113068_1175113074 9 Left 1175113068 20:56662677-56662699 CCTTACAGGGTTTGTGATGTTTC No data
Right 1175113074 20:56662709-56662731 GCTGTTATAAAGGAGCTGCTGGG No data
1175113068_1175113069 -1 Left 1175113068 20:56662677-56662699 CCTTACAGGGTTTGTGATGTTTC No data
Right 1175113069 20:56662699-56662721 CTTGTCCCCTGCTGTTATAAAGG No data
1175113068_1175113077 22 Left 1175113068 20:56662677-56662699 CCTTACAGGGTTTGTGATGTTTC No data
Right 1175113077 20:56662722-56662744 AGCTGCTGGGCTGGGCGCAGTGG No data
1175113068_1175113073 8 Left 1175113068 20:56662677-56662699 CCTTACAGGGTTTGTGATGTTTC No data
Right 1175113073 20:56662708-56662730 TGCTGTTATAAAGGAGCTGCTGG No data
1175113068_1175113075 13 Left 1175113068 20:56662677-56662699 CCTTACAGGGTTTGTGATGTTTC No data
Right 1175113075 20:56662713-56662735 TTATAAAGGAGCTGCTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175113068 Original CRISPR GAAACATCACAAACCCTGTA AGG (reversed) Intergenic
No off target data available for this crispr