ID: 1175116132

View in Genome Browser
Species Human (GRCh38)
Location 20:56683811-56683833
Sequence CTGGAGCAGAAGCAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175116130_1175116132 6 Left 1175116130 20:56683782-56683804 CCGGGTGGCTGTGTTTGTGCTGT No data
Right 1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG No data
1175116129_1175116132 16 Left 1175116129 20:56683772-56683794 CCTGCGAGCTCCGGGTGGCTGTG No data
Right 1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175116132 Original CRISPR CTGGAGCAGAAGCAGCAGAG AGG Intergenic
No off target data available for this crispr