ID: 1175117587

View in Genome Browser
Species Human (GRCh38)
Location 20:56694033-56694055
Sequence GCCTGAAGCTTGTACACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175117587_1175117591 21 Left 1175117587 20:56694033-56694055 CCAAGAGTGTACAAGCTTCAGGC No data
Right 1175117591 20:56694077-56694099 CATGATTTTTTTCCAAGATGTGG No data
1175117587_1175117589 -8 Left 1175117587 20:56694033-56694055 CCAAGAGTGTACAAGCTTCAGGC No data
Right 1175117589 20:56694048-56694070 CTTCAGGCACAGATGGATCTAGG No data
1175117587_1175117590 -7 Left 1175117587 20:56694033-56694055 CCAAGAGTGTACAAGCTTCAGGC No data
Right 1175117590 20:56694049-56694071 TTCAGGCACAGATGGATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175117587 Original CRISPR GCCTGAAGCTTGTACACTCT TGG (reversed) Intergenic
No off target data available for this crispr